Incidental Mutation 'R6357:Olfr726'
ID512394
Institutional Source Beutler Lab
Gene Symbol Olfr726
Ensembl Gene ENSMUSG00000060523
Gene Nameolfactory receptor 726
SynonymsMOR246-4, GA_x6K02T2PMLR-5775299-5774334
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6357 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50083570-50090953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50083989 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 231 (A231S)
Ref Sequence ENSEMBL: ENSMUSP00000149373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072370] [ENSMUST00000206834] [ENSMUST00000213345] [ENSMUST00000215105] [ENSMUST00000215278] [ENSMUST00000217025] [ENSMUST00000217319] [ENSMUST00000217422]
Predicted Effect probably damaging
Transcript: ENSMUST00000072370
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072207
Gene: ENSMUSG00000060523
AA Change: A231S

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 288 5.4e-8 PFAM
Pfam:7tm_1 41 287 7.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206834
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000213345
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215105
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215278
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217025
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217319
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217422
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Esam T C 9: 37,537,780 *395R probably null Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Klhdc8a A T 1: 132,303,153 Q252L probably damaging Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Msh6 T A 17: 87,984,460 Y214* probably null Het
Nefl A G 14: 68,084,318 E119G probably damaging Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Psma1 T C 7: 114,274,367 probably null Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Sirpb1b A T 3: 15,503,183 V366E possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Olfr726
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr726 APN 14 50083997 missense probably benign 0.00
IGL01432:Olfr726 APN 14 50083947 missense probably benign 0.07
IGL01788:Olfr726 APN 14 50084502 missense probably damaging 1.00
IGL01957:Olfr726 APN 14 50084280 missense probably benign 0.00
IGL02132:Olfr726 APN 14 50084486 missense probably damaging 1.00
R0611:Olfr726 UTSW 14 50083853 missense probably damaging 1.00
R0689:Olfr726 UTSW 14 50084232 missense probably benign 0.01
R1556:Olfr726 UTSW 14 50084459 missense possibly damaging 0.90
R1710:Olfr726 UTSW 14 50084370 missense probably benign 0.01
R1791:Olfr726 UTSW 14 50084042 missense probably benign 0.03
R1804:Olfr726 UTSW 14 50083902 missense probably damaging 0.99
R1853:Olfr726 UTSW 14 50084120 missense probably damaging 1.00
R2034:Olfr726 UTSW 14 50083983 missense probably benign 0.34
R3155:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3156:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3939:Olfr726 UTSW 14 50083716 makesense probably null
R4392:Olfr726 UTSW 14 50084603 missense probably benign 0.24
R4533:Olfr726 UTSW 14 50083699 unclassified probably null
R4694:Olfr726 UTSW 14 50084019 missense probably benign
R5183:Olfr726 UTSW 14 50084546 missense probably damaging 0.99
R5859:Olfr726 UTSW 14 50084027 missense probably damaging 1.00
R6186:Olfr726 UTSW 14 50084525 missense probably damaging 0.98
R6771:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6834:Olfr726 UTSW 14 50084228 missense probably damaging 0.99
R6924:Olfr726 UTSW 14 50083850 missense possibly damaging 0.91
R8043:Olfr726 UTSW 14 50083910 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCCTCAGCTTTGACATAGCTGC -3'
(R):5'- TGGCATTCACTGTTAACTTGCC -3'

Sequencing Primer
(F):5'- AGCTTTGACATAGCTGCTTTCAC -3'
(R):5'- GGTCCTAACCAGGTGGACAG -3'
Posted On2018-04-27