Mutagenetix > Incidental Mutations

Incidental Mutation 'R6357:Eml5'

512389

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

R6357 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98870884 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 357 (H357L)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: H318L

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: H318L

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: H357L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 97.8%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	G	6: 48,930,974	M303V	probably benign	Het
1700061G19Rik	T	C	17: 56,877,591		probably null	Het
3632451O06Rik	A	T	14: 49,773,312	S313T	probably benign	Het
Calcr	T	C	6: 3,714,710	D140G	probably benign	Het
Card10	T	C	15: 78,799,379	E188G	probably damaging	Het
Cenpq	T	C	17: 40,924,527	E193G	probably damaging	Het
Cep164	G	A	9: 45,770,884	L1874F	probably damaging	Het
Dennd3	T	C	15: 73,556,472	M889T	possibly damaging	Het
Dnah9	T	C	11: 65,874,196	K3841E	probably damaging	Het
Eci2	A	G	13: 34,993,099	V26A	possibly damaging	Het
Eftud2	A	T	11: 102,864,780	N200K	probably damaging	Het
Esam	T	C	9: 37,537,780	*395R	probably null	Het
Fam205a1	T	A	4: 42,850,393	I588F	probably damaging	Het
Galt	C	T	4: 41,757,565	P246S	probably benign	Het
Gjb3	A	T	4: 127,326,630	Y36*	probably null	Het
Gli2	T	C	1: 118,841,959	E621G	probably damaging	Het
Gls	T	C	1: 52,219,506	D201G	probably damaging	Het
Gm10801	C	CGTCA	2: 98,663,807		probably null	Het
Gm1110	T	C	9: 26,914,128		probably null	Het
Gm5565	T	A	5: 146,160,473	H13L	possibly damaging	Het
Hydin	A	C	8: 110,541,657	T2923P	possibly damaging	Het
Kank1	A	T	19: 25,411,353	I797L	probably benign	Het
Klhdc8a	A	T	1: 132,303,153	Q252L	probably damaging	Het
Kmt5c	T	C	7: 4,742,205	F65S	possibly damaging	Het
Lix1	C	T	17: 17,445,993	P138L	probably benign	Het
Lnpep	T	C	17: 17,552,914	N664S	probably benign	Het
Msh6	T	A	17: 87,984,460	Y214*	probably null	Het
Nefl	A	G	14: 68,084,318	E119G	probably damaging	Het
Nptxr	C	A	15: 79,794,315	R257L	possibly damaging	Het
Olfr726	C	A	14: 50,083,989	A231S	probably damaging	Het
Olfr866	T	A	9: 20,027,629	Q103L	probably damaging	Het
Oxct2b	A	G	4: 123,116,916	I210V	probably benign	Het
Plppr3	T	A	10: 79,865,406	Q534L	probably benign	Het
Psma1	T	C	7: 114,274,367		probably null	Het
Rbp3	G	A	14: 33,957,034	A980T	probably damaging	Het
Ripply2	T	A	9: 87,016,278	S58R	possibly damaging	Het
Robo1	T	C	16: 72,970,302	V454A	probably benign	Het
Sacs	A	G	14: 61,208,824	D2773G	possibly damaging	Het
Sirpb1b	A	T	3: 15,503,183	V366E	possibly damaging	Het
Slc5a7	T	C	17: 54,287,361	I197M	probably benign	Het
Srgap2	T	C	1: 131,355,542	Y267C	probably damaging	Het
Ssc4d	T	C	5: 135,966,096	T189A	probably benign	Het
Tas2r106	A	G	6: 131,677,962	*309Q	probably null	Het
Tctex1d2	T	G	16: 32,429,055		probably null	Het
Theg	T	C	10: 79,586,955	S38G	probably benign	Het
Vmn2r44	T	C	7: 8,370,658	M511V	probably benign	Het
Wdfy4	G	T	14: 33,101,049	Y1364*	probably null	Het
Zbtb8a	T	C	4: 129,354,299	H393R	probably benign	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAAGAGCAACGAGTACTATACAC -3'
(R):5'- CAAACTGTTCCTGGCTGTGTATG -3'

Sequencing Primer
(F):5'- GAGCAACGAGTACTATACACATTAAC -3'
(R):5'- ACTACTTTGGGAAGCTGCC -3'

Posted On

2018-04-27