Incidental Mutation 'R6565:Gsdme'
ID522613
Institutional Source Beutler Lab
Gene Symbol Gsdme
Ensembl Gene ENSMUSG00000029821
Gene Namegasdermin E
Synonyms4932441K13Rik, Dfna5h, Dfna5, Fin15, 2310037D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6565 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location50188888-50263862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50229449 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 138 (N138S)
Ref Sequence ENSEMBL: ENSMUSP00000126759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031845] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000170142]
Predicted Effect probably damaging
Transcript: ENSMUST00000031845
AA Change: N138S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031845
Gene: ENSMUSG00000029821
AA Change: N138S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 4.8e-167 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101405
AA Change: N138S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821
AA Change: N138S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165099
AA Change: N138S

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821
AA Change: N138S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170142
AA Change: N138S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126759
Gene: ENSMUSG00000029821
AA Change: N138S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 2.3e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal numbers of cochlear hair cell but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg C A 15: 60,920,810 C96F probably damaging Het
Abca7 C T 10: 80,011,788 P1764L probably damaging Het
Acvr1 G A 2: 58,479,757 T80M probably damaging Het
Adgrb2 T C 4: 130,019,276 L1398P probably damaging Het
B4galnt3 G A 6: 120,217,479 Q362* probably null Het
Cadm3 G T 1: 173,341,709 Q246K possibly damaging Het
Cdc14b T C 13: 64,225,630 T110A probably benign Het
Cyp2c55 A C 19: 39,042,122 D466A probably benign Het
Dmrtb1 T C 4: 107,679,345 Y308C probably damaging Het
Fat3 T C 9: 15,915,327 D4443G probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Grin2d A G 7: 45,834,755 L772P probably damaging Het
Hmgb4 T A 4: 128,260,595 Y60F probably benign Het
Ift172 G A 5: 31,275,883 A554V possibly damaging Het
Iigp1 T A 18: 60,390,767 V319E probably damaging Het
Kit A G 5: 75,645,853 T673A probably damaging Het
Lilra6 A T 7: 3,915,020 W42R probably benign Het
Mia3 A T 1: 183,331,485 H477Q probably damaging Het
Oas1b C A 5: 120,814,546 Q101K possibly damaging Het
Olfr56 A G 11: 49,134,812 M207V probably damaging Het
Olfr586 T C 7: 103,122,238 H178R probably damaging Het
Plcl1 T A 1: 55,697,958 C819* probably null Het
Pmfbp1 C T 8: 109,525,428 Q402* probably null Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Skor2 C G 18: 76,859,912 A443G possibly damaging Het
Tapbpl A G 6: 125,228,344 V213A probably benign Het
Trim52 G A 14: 106,107,219 D104N probably damaging Het
Other mutations in Gsdme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gsdme APN 6 50229284 critical splice donor site probably null
IGL01462:Gsdme APN 6 50227374 missense possibly damaging 0.94
IGL01645:Gsdme APN 6 50251336 missense probably damaging 1.00
IGL01836:Gsdme APN 6 50222789 missense probably damaging 1.00
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0110:Gsdme UTSW 6 50246127 splice site probably benign
R0396:Gsdme UTSW 6 50221107 missense probably benign 0.00
R0510:Gsdme UTSW 6 50246127 splice site probably benign
R0627:Gsdme UTSW 6 50229279 splice site probably benign
R1350:Gsdme UTSW 6 50246128 splice site probably null
R1992:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2973:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R2974:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R3154:Gsdme UTSW 6 50251363 missense probably damaging 0.99
R3816:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3818:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3819:Gsdme UTSW 6 50219411 missense probably benign 0.41
R4035:Gsdme UTSW 6 50229448 missense possibly damaging 0.50
R4519:Gsdme UTSW 6 50229353 missense probably damaging 1.00
R4669:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R4678:Gsdme UTSW 6 50229324 missense possibly damaging 0.87
R5009:Gsdme UTSW 6 50246012 missense possibly damaging 0.64
R5370:Gsdme UTSW 6 50229306 missense probably damaging 0.98
R5768:Gsdme UTSW 6 50219300 nonsense probably null
R5811:Gsdme UTSW 6 50245945 missense probably benign 0.02
R5975:Gsdme UTSW 6 50227359 missense probably benign 0.30
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6089:Gsdme UTSW 6 50251305 missense probably damaging 0.99
R6862:Gsdme UTSW 6 50227398 missense probably damaging 1.00
R7169:Gsdme UTSW 6 50227378 missense probably benign 0.00
R7720:Gsdme UTSW 6 50229308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTTCTCCATGCCGAG -3'
(R):5'- GCACTTCTTCCAGTGTCCAG -3'

Sequencing Primer
(F):5'- AAGTTCTCCATGCCGAGGTGTG -3'
(R):5'- AGTGGCCTCAGGAGAGCTTG -3'
Posted On2018-06-06