Incidental Mutation 'R4519:Gsdme'
ID334112
Institutional Source Beutler Lab
Gene Symbol Gsdme
Ensembl Gene ENSMUSG00000029821
Gene Namegasdermin E
Synonyms4932441K13Rik, Dfna5h, Dfna5, Fin15, 2310037D07Rik
MMRRC Submission 041590-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4519 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location50188888-50263862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50229353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 170 (I170N)
Ref Sequence ENSEMBL: ENSMUSP00000126759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031845] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000170142]
Predicted Effect probably damaging
Transcript: ENSMUST00000031845
AA Change: I170N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031845
Gene: ENSMUSG00000029821
AA Change: I170N

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 4.8e-167 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101405
AA Change: I170N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821
AA Change: I170N

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165099
AA Change: I170N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821
AA Change: I170N

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170142
AA Change: I170N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126759
Gene: ENSMUSG00000029821
AA Change: I170N

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 2.3e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal numbers of cochlear hair cell but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 noncoding transcript Het
Acadsb A T 7: 131,430,004 T190S probably damaging Het
Adamts17 G T 7: 66,840,566 G132V probably damaging Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Atp8b4 A T 2: 126,414,459 probably null Het
Btbd18 T C 2: 84,667,580 Y521H probably damaging Het
Casd1 A G 6: 4,621,102 N220S probably benign Het
Ccdc112 T G 18: 46,287,546 E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cntrl A T 2: 35,173,111 K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 I544F unknown Het
Cyp20a1 A T 1: 60,387,147 Y416F probably damaging Het
Dagla T C 19: 10,269,732 K132E probably damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 V329E probably damaging Het
Dhx32 A T 7: 133,734,109 Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 P174Q probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam214a A G 9: 75,023,647 I957M probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Ghr T A 15: 3,333,488 L167F probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm9767 T C 10: 26,078,858 probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Kmt2c T A 5: 25,363,477 K867M probably damaging Het
Krt35 A G 11: 100,094,627 V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 M1558L probably benign Het
Mcam T G 9: 44,141,343 M623R possibly damaging Het
Mrps26 A T 2: 130,564,349 Q134L probably benign Het
Mxra8 T C 4: 155,842,983 probably null Het
Olfr532 A G 7: 140,419,210 S188P probably damaging Het
Olfr659 G A 7: 104,670,839 G46R probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Parg C A 14: 32,209,635 T404K probably damaging Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Piezo2 T C 18: 63,072,880 E1486G probably damaging Het
Pign A T 1: 105,597,666 probably null Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 probably null Het
Ptdss2 A G 7: 141,154,578 T309A probably benign Het
Ptprt T C 2: 161,564,689 M987V probably damaging Het
Rgs17 C A 10: 5,918,192 L9F probably benign Het
Rock2 A G 12: 16,977,737 R168G probably damaging Het
Rsph4a T A 10: 33,911,627 L593* probably null Het
Scaf11 C A 15: 96,424,838 K108N probably damaging Het
Sec23b T A 2: 144,582,015 M528K possibly damaging Het
Shank2 G A 7: 144,410,205 D727N probably damaging Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Spatc1 A T 15: 76,292,485 I479F probably damaging Het
Tmem126b A G 7: 90,469,108 L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 F829L probably damaging Het
Other mutations in Gsdme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gsdme APN 6 50229284 critical splice donor site probably null
IGL01462:Gsdme APN 6 50227374 missense possibly damaging 0.94
IGL01645:Gsdme APN 6 50251336 missense probably damaging 1.00
IGL01836:Gsdme APN 6 50222789 missense probably damaging 1.00
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0110:Gsdme UTSW 6 50246127 splice site probably benign
R0396:Gsdme UTSW 6 50221107 missense probably benign 0.00
R0510:Gsdme UTSW 6 50246127 splice site probably benign
R0627:Gsdme UTSW 6 50229279 splice site probably benign
R1350:Gsdme UTSW 6 50246128 splice site probably null
R1992:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2973:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R2974:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R3154:Gsdme UTSW 6 50251363 missense probably damaging 0.99
R3816:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3818:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3819:Gsdme UTSW 6 50219411 missense probably benign 0.41
R4035:Gsdme UTSW 6 50229448 missense possibly damaging 0.50
R4669:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R4678:Gsdme UTSW 6 50229324 missense possibly damaging 0.87
R5009:Gsdme UTSW 6 50246012 missense possibly damaging 0.64
R5370:Gsdme UTSW 6 50229306 missense probably damaging 0.98
R5768:Gsdme UTSW 6 50219300 nonsense probably null
R5811:Gsdme UTSW 6 50245945 missense probably benign 0.02
R5975:Gsdme UTSW 6 50227359 missense probably benign 0.30
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6089:Gsdme UTSW 6 50251305 missense probably damaging 0.99
R6565:Gsdme UTSW 6 50229449 missense probably damaging 0.97
R6862:Gsdme UTSW 6 50227398 missense probably damaging 1.00
R7169:Gsdme UTSW 6 50227378 missense probably benign 0.00
R7720:Gsdme UTSW 6 50229308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTAGAGCCAGCGTGAGTC -3'
(R):5'- CATCACCAGGGAATTAATGAGCTC -3'

Sequencing Primer
(F):5'- AGCGTGAGTCCGTCCCATTC -3'
(R):5'- CTGCAAGAGGATATTCTGGTCCC -3'
Posted On2015-08-18