Incidental Mutation 'R6769:C1rb'
ID532086
Institutional Source Beutler Lab
Gene Symbol C1rb
Ensembl Gene ENSMUSG00000098470
Gene Namecomplement component 1, r subcomponent B
SynonymsGm8551, mC1rB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R6769 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124570294-124581171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 124577405 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 382 (S382A)
Ref Sequence ENSEMBL: ENSMUSP00000139376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184647]
Predicted Effect probably benign
Transcript: ENSMUST00000184647
AA Change: S382A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139376
Gene: ENSMUSG00000098470
AA Change: S382A

DomainStartEndE-ValueType
CUB 14 140 2.21e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 2.42e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 698 5.36e-75 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Alox5 C A 6: 116,415,184 probably null Het
Amer3 C A 1: 34,588,249 A523D possibly damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Efcab5 A G 11: 77,105,432 V1101A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam129b C T 2: 32,895,654 Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Gm7361 T A 5: 26,257,769 L3* probably null Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 A T 12: 113,879,310 F46I possibly damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Mnat1 A G 12: 73,272,422 N273S probably benign Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Prdm5 T A 6: 65,862,936 I265K probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rassf4 T A 6: 116,641,472 D215V possibly damaging Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Scn8a A G 15: 101,035,564 N1550D probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc30a5 A C 13: 100,813,860 S240A probably benign Het
Slc7a4 A G 16: 17,575,320 V205A possibly damaging Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Vmn2r83 T A 10: 79,478,022 S155T probably damaging Het
Other mutations in C1rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3722:C1rb UTSW 6 124580661 missense probably damaging 1.00
R4806:C1rb UTSW 6 124574949 missense probably benign 0.18
R5095:C1rb UTSW 6 124580313 missense possibly damaging 0.91
R5572:C1rb UTSW 6 124580799 missense probably benign
R6223:C1rb UTSW 6 124574580 missense probably benign 0.06
R6771:C1rb UTSW 6 124577405 missense probably benign 0.00
R7204:C1rb UTSW 6 124577427 missense probably benign
R7335:C1rb UTSW 6 124575279 missense possibly damaging 0.87
R7341:C1rb UTSW 6 124577452 nonsense probably null
R7554:C1rb UTSW 6 124580406 missense probably damaging 1.00
R7604:C1rb UTSW 6 124580484 missense not run
R7753:C1rb UTSW 6 124580431 missense probably benign 0.00
R7813:C1rb UTSW 6 124580529 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAAGCTGTTTAGGCCTCATCTC -3'
(R):5'- AATGTCAGGTGTCTCTCAGAGC -3'

Sequencing Primer
(F):5'- TCCAACCTGATGGGCTCTG -3'
(R):5'- GTGTCTCTCAGAGCGGAAAG -3'
Posted On2018-08-29