Incidental Mutation 'R6844:Pdcd1'

• ID: 534652
• Institutional Source: Beutler Lab
• Gene Symbol: Pdcd1
• Ensembl Gene: ENSMUSG00000026285
• Gene Name: programmed cell death 1
• Synonyms: Pdc1, PD-1
• MMRRC Submission: 044950-MU
• Essential gene?: Possibly non essential (E-score: 0.339)
• Stock #: R6844 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 1
• Chromosomal Location: 93966027-93980278 bp(-) (GRCm39)
• Type of Mutation: missense
• DNA Base Change (assembly): C to T at 93967106 bp (GRCm39)
• Zygosity: Heterozygous
• Amino Acid Change: Arginine to Histidine at position 264 (R264H)
• Ref Sequence: ENSEMBL: ENSMUSP00000027507
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000027507]
• AlphaFold: Q02242
• PDB Structure: CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION] ; Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION] ; Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION] ; Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION] ; Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION] ; Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION] ; Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
• Predicted Effect: probably benign; Transcript: ENSMUST00000027507; AA Change: R264H; PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
• SMART Domains: Protein: ENSMUSP00000027507; Gene: ENSMUSG00000026285; AA Change: R264H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	39	145	3.33e-9	SMART
transmembrane domain	170	192	N/A	INTRINSIC

• Meta Mutation Damage Score: 0.3243
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
• Validation Efficiency: 92% (36/39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
• Posted On: 2018-09-12

Predicted Primers

PCR Primer
(F):5'- TGAACTGTAGCCTGCATGC -3'
(R):5'- TTATGGGATGCACACACCAC -3'

Sequencing Primer
(F):5'- GCATGCTCCTCTTGACTGAG -3'
(R):5'- CAACTGACTATAACAATGGCTCTTTC -3'