Mutagenetix > Incidental Mutations

Incidental Mutation 'R6844:Rapgef4'

534656

Institutional Source

Beutler Lab

Gene Symbol

Rapgef4

Ensembl Gene

ENSMUSG00000049044

Gene Name

Rap guanine nucleotide exchange factor (GEF) 4

Synonyms

cAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.652) question?

Stock #

R6844 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71981240-72257474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72234626 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 656 (T656A)

Ref Sequence

ENSEMBL: ENSMUSP00000028525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028525
AA Change: T656A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: T656A

Domain	Start	End	E-Value	Type
DEP	72	147	3.43e-27	SMART
low complexity region	158	167	N/A	INTRINSIC
cNMP	212	331	4.02e-15	SMART
RasGEFN	351	486	3.61e-7	SMART
Blast:RasGEF	534	607	1e-33	BLAST
RasGEF	624	866	8.09e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000090826
AA Change: T800A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: T800A

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102698
AA Change: T782A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: T782A

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Meta Mutation Damage Score

0.2868

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap18	G	A	10: 26,772,686	A35T	probably benign	Het
Arhgap21	A	G	2: 20,881,305	S354P	probably benign	Het
Casq2	A	T	3: 102,110,262	H86L	possibly damaging	Het
Ccdc188	G	A	16: 18,218,210	G83E	probably damaging	Het
Cd22	G	T	7: 30,873,431		probably null	Het
Cyp2b13	T	A	7: 26,081,697	I178N	probably damaging	Het
Cyp4a31	T	A	4: 115,563,792	C26S	probably null	Het
Eif3h	T	C	15: 51,865,333	D42G	possibly damaging	Het
Elovl4	T	A	9: 83,790,111	I52L	probably benign	Het
Fgfbp3	C	A	19: 36,918,880	A113S	possibly damaging	Het
Fsip2	A	T	2: 82,983,625	K3429N	possibly damaging	Het
Gemin5	T	C	11: 58,163,904	D224G	probably benign	Het
Gm3415	T	C	5: 146,558,001	I158T	probably benign	Het
Gpr22	C	A	12: 31,709,952	R20L	probably benign	Het
Htr1a	A	G	13: 105,444,947	K232E	possibly damaging	Het
Itgax	T	A	7: 128,147,934		probably null	Het
Jag2	T	C	12: 112,916,714	Y310C	probably damaging	Het
Lce1j	A	G	3: 92,789,349	S41P	unknown	Het
Mllt10	A	G	2: 18,159,483	I197V	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Mybpc1	T	A	10: 88,536,381	I796F	possibly damaging	Het
Nr2c1	T	A	10: 94,171,167	L289*	probably null	Het
Omp	T	A	7: 98,145,076	M115L	probably benign	Het
Pdcd1	C	T	1: 94,039,381	R264H	probably benign	Het
Plxna2	T	C	1: 194,793,828	F1119L	probably benign	Het
Ralyl	A	G	3: 13,776,878	T25A	probably damaging	Het
Ripor3	C	T	2: 167,993,333		probably null	Het
Samd8	T	C	14: 21,775,137	S54P	probably damaging	Het
Serpinb9g	A	T	13: 33,486,633	I35F	probably damaging	Het
Shisa8	T	C	15: 82,212,109	S102G	probably damaging	Het
Slc4a1ap	T	A	5: 31,527,478	S153T	probably damaging	Het
Slc4a4	T	A	5: 89,228,972	D1028E	probably damaging	Het
Slc6a13	T	A	6: 121,325,053	I198N	probably damaging	Het
Sst	C	T	16: 23,889,842	D80N	probably benign	Het
Synj2	A	G	17: 5,975,806	K47E	probably damaging	Het
Tal1	C	T	4: 115,063,267	P46L	probably benign	Het
Top2b	A	T	14: 16,429,383	N1541I	possibly damaging	Het
Vps13b	T	A	15: 35,877,590	N2903K	probably benign	Het
Zfp949	A	G	9: 88,569,411	T345A	possibly damaging	Het
Zmat3	A	G	3: 32,341,495	Y288H	probably damaging	Het

Other mutations in Rapgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rapgef4	APN	2	72256312	missense	possibly damaging	0.75
IGL00858:Rapgef4	APN	2	72198897	missense	probably damaging	1.00
IGL01408:Rapgef4	APN	2	72174841	nonsense	probably null
IGL01673:Rapgef4	APN	2	72241437	missense	probably damaging	0.99
IGL01678:Rapgef4	APN	2	72242225	splice site	probably benign
IGL01725:Rapgef4	APN	2	72174874	missense	probably benign	0.24
IGL01871:Rapgef4	APN	2	72198360	missense	possibly damaging	0.69
IGL01935:Rapgef4	APN	2	72234123	missense	probably benign	0.05
IGL02001:Rapgef4	APN	2	72225052	splice site	probably benign
IGL02041:Rapgef4	APN	2	72198796	missense	probably damaging	1.00
IGL02134:Rapgef4	APN	2	72180061	missense	probably damaging	0.97
IGL02410:Rapgef4	APN	2	72226594	missense	possibly damaging	0.51
IGL02807:Rapgef4	APN	2	72205649	splice site	probably benign
IGL03066:Rapgef4	APN	2	72141179	splice site	probably benign
IGL03282:Rapgef4	APN	2	72205752	splice site	probably benign
IGL03291:Rapgef4	APN	2	72195703	missense	probably damaging	1.00
P0033:Rapgef4	UTSW	2	72137331	intron	probably benign
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0309:Rapgef4	UTSW	2	72226030	missense	probably benign	0.02
R0398:Rapgef4	UTSW	2	72031041	missense	probably damaging	0.99
R0747:Rapgef4	UTSW	2	72223073	missense	possibly damaging	0.66
R1216:Rapgef4	UTSW	2	72208148	missense	possibly damaging	0.51
R1264:Rapgef4	UTSW	2	72031105	missense	possibly damaging	0.48
R1302:Rapgef4	UTSW	2	72045160	missense	probably benign	0.31
R1460:Rapgef4	UTSW	2	72031176	critical splice donor site	probably null
R1483:Rapgef4	UTSW	2	72055026	critical splice donor site	probably null
R1682:Rapgef4	UTSW	2	72226568	missense	possibly damaging	0.80
R1768:Rapgef4	UTSW	2	72225787	splice site	probably benign
R1858:Rapgef4	UTSW	2	72031064	missense	possibly damaging	0.67
R1860:Rapgef4	UTSW	2	72234720	missense	probably benign	0.05
R1952:Rapgef4	UTSW	2	72208127	missense	probably benign	0.07
R2025:Rapgef4	UTSW	2	72242739	missense	probably benign	0.01
R2128:Rapgef4	UTSW	2	72226553	missense	possibly damaging	0.87
R2159:Rapgef4	UTSW	2	72174881	missense	probably damaging	1.00
R2201:Rapgef4	UTSW	2	72045189	missense	probably damaging	0.96
R2883:Rapgef4	UTSW	2	72031125	missense	probably benign
R3015:Rapgef4	UTSW	2	72198373	missense	probably damaging	1.00
R4278:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R5256:Rapgef4	UTSW	2	72034034	missense	probably damaging	0.97
R5572:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5574:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5575:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5749:Rapgef4	UTSW	2	72242757	missense	probably damaging	1.00
R6007:Rapgef4	UTSW	2	72179949	missense	possibly damaging	0.55
R6084:Rapgef4	UTSW	2	72196278	critical splice donor site	probably null
R6192:Rapgef4	UTSW	2	71981317	missense	probably benign	0.00
R6409:Rapgef4	UTSW	2	72178237	missense	probably benign	0.01
R6683:Rapgef4	UTSW	2	72054779	intron	probably benign
R6774:Rapgef4	UTSW	2	72225775	missense	probably benign	0.01
R6999:Rapgef4	UTSW	2	72239125	missense	probably damaging	1.00
R7077:Rapgef4	UTSW	2	72241476	missense	probably damaging	0.96
R7138:Rapgef4	UTSW	2	72198363	missense	probably damaging	1.00
R7275:Rapgef4	UTSW	2	72208101	missense	probably damaging	1.00
R7352:Rapgef4	UTSW	2	72180091	missense	probably damaging	1.00
R7397:Rapgef4	UTSW	2	72205666	missense	probably benign	0.23
R7508:Rapgef4	UTSW	2	72205733	missense	probably benign	0.00
R7620:Rapgef4	UTSW	2	72229078	missense	probably damaging	0.99
R7703:Rapgef4	UTSW	2	72179971	missense	probably benign	0.28
R7770:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R7814:Rapgef4	UTSW	2	72223117	missense	probably benign
R7868:Rapgef4	UTSW	2	72201137	missense	probably benign	0.11
R8210:Rapgef4	UTSW	2	72226020	missense	probably benign	0.00
X0062:Rapgef4	UTSW	2	72226607	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TATGTCTTCCAGAGTCTATTAAGCC -3'
(R):5'- GACACTTACTGAGCCGCTATC -3'

Sequencing Primer
(F):5'- CTTCCAGAGTCTATTAAGCCAATAAC -3'
(R):5'- AAAGGCAGACCTCAGTGA -3'

Posted On

2018-09-12