Incidental Mutation 'R6882:Kcns3'
ID536740
Institutional Source Beutler Lab
Gene Symbol Kcns3
Ensembl Gene ENSMUSG00000043673
Gene Namepotassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
SynonymsD12Ertd137e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6882 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11090202-11151056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11092048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 217 (V217M)
Ref Sequence ENSEMBL: ENSMUSP00000152026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055673] [ENSMUST00000164495] [ENSMUST00000217974]
Predicted Effect probably benign
Transcript: ENSMUST00000055673
AA Change: V217M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000060706
Gene: ENSMUSG00000043673
AA Change: V217M

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164495
AA Change: V217M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129412
Gene: ENSMUSG00000043673
AA Change: V217M

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217974
AA Change: V217M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 A G 12: 70,956,351 E238G probably benign Het
Adgrf5 T A 17: 43,450,380 C989S probably damaging Het
Ank2 T G 3: 126,945,757 probably benign Het
C2cd6 T C 1: 59,066,159 D320G probably damaging Het
Cacnb2 T A 2: 14,824,299 I15N probably benign Het
Cage1 T A 13: 38,022,558 Q437L probably damaging Het
Capn15 G T 17: 25,960,179 probably null Het
Cbll1 A G 12: 31,487,485 Y424H probably damaging Het
Ccdc166 T C 15: 75,981,617 H167R possibly damaging Het
Ccdc7a T C 8: 128,797,328 probably benign Het
Cdkl4 T A 17: 80,543,746 T176S probably damaging Het
Cnot1 T C 8: 95,720,426 E2321G possibly damaging Het
Col6a5 G A 9: 105,940,270 Q281* probably null Het
Csmd2 A G 4: 128,449,269 T1485A probably benign Het
Dmxl1 A G 18: 49,843,784 probably null Het
Dnah3 A G 7: 119,971,184 I2271T possibly damaging Het
Elavl2 A G 4: 91,308,715 I42T probably damaging Het
Epn3 C T 11: 94,491,360 A568T probably benign Het
Etv3 T C 3: 87,529,270 F111L probably damaging Het
Fnip1 A G 11: 54,509,898 E1041G probably damaging Het
Fosl2 T C 5: 32,152,864 V219A possibly damaging Het
Foxj2 T A 6: 122,828,505 probably null Het
Gm8947 G A 1: 151,193,129 A238T possibly damaging Het
Golgb1 C A 16: 36,913,990 Q1200K probably benign Het
Igkv4-55 A G 6: 69,607,305 Y108H probably damaging Het
Iglc1 G A 16: 19,061,849 probably benign Het
Ints13 G T 6: 146,563,441 R221S probably null Het
Ipo11 T C 13: 106,900,682 probably null Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Klra9 A T 6: 130,179,022 C257S probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lmbr1l A G 15: 98,907,586 F345L probably damaging Het
Lrrc18 A C 14: 33,008,689 I62L probably benign Het
Mr1 A G 1: 155,132,453 W259R possibly damaging Het
Myo15 G A 11: 60,524,006 R3325H probably damaging Het
Nid2 A G 14: 19,789,707 D788G probably damaging Het
Olfr1386 A T 11: 49,470,463 Y104F probably benign Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr192 A T 16: 59,098,627 C122S unknown Het
Olfr212 T C 6: 116,516,434 V219A probably benign Het
Pbld1 T C 10: 63,061,462 L11P probably benign Het
Pcnt T C 10: 76,427,828 E434G probably benign Het
Prg4 G A 1: 150,453,495 T174M probably damaging Het
Prkdc G A 16: 15,783,263 probably null Het
Prkdc T A 16: 15,808,156 S3349T probably benign Het
Prpf38a C A 4: 108,570,168 E199D probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Rhbg T A 3: 88,245,220 H339L probably damaging Het
Rnf183 A G 4: 62,428,024 I179T probably benign Het
Sh3bp5l G T 11: 58,331,699 A7S probably benign Het
Slc12a3 T A 8: 94,365,918 I989N possibly damaging Het
Sycp3 C T 10: 88,472,929 R246* probably null Het
Tmprss11b T A 5: 86,671,671 probably null Het
Tmx4 T C 2: 134,644,002 T2A possibly damaging Het
Tnfsf10 T C 3: 27,326,033 L82S possibly damaging Het
Tnni3k T A 3: 154,957,720 I332F possibly damaging Het
Ttn T A 2: 76,814,195 T13072S probably benign Het
Vmn2r1 A T 3: 64,090,108 Y395F possibly damaging Het
Zbbx A G 3: 75,071,712 V476A probably benign Het
Zfp341 T C 2: 154,638,023 C465R probably damaging Het
Zfp398 A G 6: 47,866,082 D224G probably damaging Het
Zfp407 G T 18: 84,343,069 probably null Het
Zfp52 T C 17: 21,555,047 M1T probably null Het
Other mutations in Kcns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Kcns3 APN 12 11092426 missense probably benign 0.40
IGL01089:Kcns3 APN 12 11091571 missense possibly damaging 0.92
IGL01448:Kcns3 APN 12 11091643 missense possibly damaging 0.91
IGL02084:Kcns3 APN 12 11092194 missense probably damaging 0.96
IGL02229:Kcns3 APN 12 11092092 missense probably damaging 1.00
IGL02730:Kcns3 APN 12 11092075 missense probably benign
IGL02820:Kcns3 APN 12 11091871 missense probably benign 0.01
IGL03390:Kcns3 APN 12 11091232 missense probably benign
PIT4696001:Kcns3 UTSW 12 11092748 start gained probably benign
R0583:Kcns3 UTSW 12 11091478 missense probably damaging 1.00
R0629:Kcns3 UTSW 12 11092558 missense probably damaging 1.00
R1549:Kcns3 UTSW 12 11092083 missense probably damaging 1.00
R1571:Kcns3 UTSW 12 11091550 missense probably damaging 1.00
R1755:Kcns3 UTSW 12 11091444 missense probably benign 0.09
R2507:Kcns3 UTSW 12 11092086 missense possibly damaging 0.67
R4348:Kcns3 UTSW 12 11091381 missense possibly damaging 0.85
R4667:Kcns3 UTSW 12 11091783 missense probably damaging 1.00
R4750:Kcns3 UTSW 12 11091654 missense probably damaging 1.00
R5704:Kcns3 UTSW 12 11092327 missense probably benign 0.05
R5770:Kcns3 UTSW 12 11092249 missense probably benign 0.15
R7014:Kcns3 UTSW 12 11091687 missense probably damaging 1.00
R8025:Kcns3 UTSW 12 11091845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCACCTTGCCCATATTC -3'
(R):5'- ATGTGAGCACAGACTCCTCC -3'

Sequencing Primer
(F):5'- GACCACCTTGCCCATATTCTCAATG -3'
(R):5'- TGAGCACAGACTCCTCCTTTGAAG -3'
Posted On2018-10-18