Incidental Mutation 'R6859:Olfr360'
ID537786
Institutional Source Beutler Lab
Gene Symbol Olfr360
Ensembl Gene ENSMUSG00000083361
Gene Nameolfactory receptor 360
SynonymsMOR159-1, GA_x6K02T2NLDC-33760081-33761034
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6859 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37065746-37069651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37068782 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 159 (Y159F)
Ref Sequence ENSEMBL: ENSMUSP00000149581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120704] [ENSMUST00000216706]
Predicted Effect probably damaging
Transcript: ENSMUST00000120704
AA Change: Y159F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114121
Gene: ENSMUSG00000083361
AA Change: Y159F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 206 6e-7 PFAM
Pfam:7tm_1 41 289 5.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216706
AA Change: Y159F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plbd2 A G 5: 120,503,342 F84L probably benign Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Olfr360
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Olfr360 APN 2 37068485 missense probably damaging 1.00
H8786:Olfr360 UTSW 2 37068329 missense probably benign 0.41
R4551:Olfr360 UTSW 2 37068343 missense probably benign 0.03
R4896:Olfr360 UTSW 2 37068410 missense probably damaging 1.00
R5004:Olfr360 UTSW 2 37068410 missense probably damaging 1.00
R5828:Olfr360 UTSW 2 37068989 missense probably benign 0.00
R6173:Olfr360 UTSW 2 37069079 missense possibly damaging 0.78
R6802:Olfr360 UTSW 2 37068415 missense probably benign
R7171:Olfr360 UTSW 2 37068388 missense possibly damaging 0.91
R7712:Olfr360 UTSW 2 37068904 missense probably damaging 1.00
R7798:Olfr360 UTSW 2 37069174 missense probably damaging 1.00
T0722:Olfr360 UTSW 2 37068437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGCATTTCCTATAATCGTTG -3'
(R):5'- GGCCATGGCAATACCTATTCG -3'

Sequencing Primer
(F):5'- GCATTTCCTATAATCGTTGCATGAC -3'
(R):5'- CATGGCAATACCTATTCGAACATAAG -3'
Posted On2018-10-18