Incidental Mutation 'R6859:Plbd2'
ID537801
Institutional Source Beutler Lab
Gene Symbol Plbd2
Ensembl Gene ENSMUSG00000029598
Gene Namephospholipase B domain containing 2
Synonyms66.3 kDa, p76, 1300012G16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6859 (G1)
Quality Score169.009
Status Validated
Chromosome5
Chromosomal Location120483282-120503625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120503342 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 84 (F84L)
Ref Sequence ENSEMBL: ENSMUSP00000031597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031597]
PDB Structure
Crystal structure of the lysosomal 66.3 kDa protein from mouse solved by S-SAD [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein at 1.8 Angstroem [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein from mouse lacking the linker peptide [X-RAY DIFFRACTION]
One chain form of the 66.3 kDa protein [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031597
AA Change: F84L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031597
Gene: ENSMUSG00000029598
AA Change: F84L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Phospholip_B 62 591 2.9e-179 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,935 V788A possibly damaging Het
Abca15 A T 7: 120,402,994 K1577* probably null Het
Arhgap12 T C 18: 6,111,803 E187G probably damaging Het
Arhgef10 T A 8: 14,975,005 Y398N probably damaging Het
Baz2b C T 2: 59,901,530 V2055I probably benign Het
Btnl4 T C 17: 34,469,379 D475G probably damaging Het
C1qtnf12 T A 4: 155,965,613 F190Y probably damaging Het
Cacul1 A G 19: 60,534,245 S284P probably damaging Het
Ccdc166 C A 15: 75,981,971 V87L possibly damaging Het
Ceacam13 C T 7: 18,013,107 P162S probably damaging Het
Cep250 T A 2: 155,992,526 S2124T probably benign Het
Chd5 T C 4: 152,378,207 S1372P probably damaging Het
Chil3 C A 3: 106,160,414 R145L probably benign Het
Cyp4f40 T C 17: 32,675,949 S454P probably benign Het
Defa3 T A 8: 21,288,197 C66S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Glmp C A 3: 88,328,042 N260K probably benign Het
Gsap T A 5: 21,281,018 L653Q probably damaging Het
Il18rap T A 1: 40,525,095 Y124* probably null Het
Lao1 A C 4: 118,963,751 K58T probably damaging Het
Lepr T A 4: 101,765,290 probably null Het
Mrgpra3 G C 7: 47,590,033 I48M probably benign Het
Nck2 T G 1: 43,554,351 N239K probably benign Het
Olfr1208 A G 2: 88,896,934 I221T probably benign Het
Olfr360 A T 2: 37,068,782 Y159F probably damaging Het
Olfr65 G A 7: 103,906,701 W84* probably null Het
Optc A T 1: 133,897,816 V324E possibly damaging Het
Otog T C 7: 46,273,781 S1027P probably damaging Het
Plxnb1 T C 9: 109,106,770 L110P probably damaging Het
Prnp T C 2: 131,936,788 V120A possibly damaging Het
Ptprh C A 7: 4,549,371 E965* probably null Het
Reln T C 5: 22,034,570 T900A probably damaging Het
Stt3a A G 9: 36,735,386 Y644H probably damaging Het
Sulf2 A G 2: 166,087,119 Y311H probably damaging Het
Tbc1d32 A T 10: 56,180,530 I438N probably damaging Het
Tbcd T C 11: 121,497,111 V356A possibly damaging Het
Tecta T C 9: 42,392,129 N69S probably damaging Het
Topaz1 T C 9: 122,801,958 V1618A probably benign Het
Usp48 C T 4: 137,625,276 T627I possibly damaging Het
Vcl T C 14: 20,987,075 V247A probably damaging Het
Vmn2r59 A G 7: 42,043,853 L441P probably damaging Het
Zfp869 C T 8: 69,706,525 G466D probably damaging Het
Other mutations in Plbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Plbd2 APN 5 120485810 missense possibly damaging 0.57
IGL01635:Plbd2 APN 5 120499049 missense probably damaging 1.00
IGL02017:Plbd2 APN 5 120488558 missense probably damaging 1.00
IGL02040:Plbd2 APN 5 120487442 missense probably damaging 1.00
IGL03094:Plbd2 APN 5 120486780 missense probably damaging 1.00
IGL03124:Plbd2 APN 5 120493077 missense possibly damaging 0.68
R0077:Plbd2 UTSW 5 120486039 critical splice donor site probably null
R0087:Plbd2 UTSW 5 120494485 nonsense probably null
R0294:Plbd2 UTSW 5 120487449 unclassified probably null
R1682:Plbd2 UTSW 5 120485784 missense probably damaging 0.97
R1818:Plbd2 UTSW 5 120487509 splice site probably null
R3796:Plbd2 UTSW 5 120492868 missense probably damaging 1.00
R4935:Plbd2 UTSW 5 120486721 missense possibly damaging 0.95
R5082:Plbd2 UTSW 5 120491184 nonsense probably null
R5420:Plbd2 UTSW 5 120494482 missense probably damaging 0.98
R5441:Plbd2 UTSW 5 120499082 missense probably benign
R5582:Plbd2 UTSW 5 120493106 missense probably benign 0.00
R5643:Plbd2 UTSW 5 120493166 splice site probably null
R6831:Plbd2 UTSW 5 120493066 missense probably benign 0.03
R7343:Plbd2 UTSW 5 120493149 missense probably damaging 1.00
R7436:Plbd2 UTSW 5 120486796 missense probably damaging 1.00
R7779:Plbd2 UTSW 5 120487678 missense probably damaging 1.00
R7789:Plbd2 UTSW 5 120485754 missense probably damaging 1.00
Z1177:Plbd2 UTSW 5 120503599 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAGTTACTGAGTCAGCCACCAG -3'
(R):5'- AGAGCGCGAGTCCTTTAAGG -3'

Sequencing Primer
(F):5'- AGTCAGCCACCAGCCCTG -3'
(R):5'- AGTCCTTTAAGGCAGGCCC -3'
Posted On2018-10-18