Incidental Mutation 'R6933:Cdc40'
ID540165
Institutional Source Beutler Lab
Gene Symbol Cdc40
Ensembl Gene ENSMUSG00000038446
Gene Namecell division cycle 40
SynonymsPRP17, 1200003H23Rik, EHB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6933 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40831621-40883311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40844996 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 318 (V318A)
Ref Sequence ENSEMBL: ENSMUSP00000044305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044166]
Predicted Effect probably damaging
Transcript: ENSMUST00000044166
AA Change: V318A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044305
Gene: ENSMUSG00000038446
AA Change: V318A

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
WD40 277 317 6.04e-8 SMART
WD40 321 360 8.1e-9 SMART
WD40 363 404 1.58e-2 SMART
WD40 407 446 9.52e-6 SMART
WD40 452 489 2.13e1 SMART
WD40 495 536 1.4e-3 SMART
WD40 539 579 3.37e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Ank3 G T 10: 69,904,212 K814N probably damaging Het
Anks1b A G 10: 90,069,490 H231R probably damaging Het
Anks6 A G 4: 47,049,164 V247A probably benign Het
Antxrl A G 14: 34,075,771 N568D possibly damaging Het
Ccnl1 T C 3: 65,947,952 T366A probably benign Het
Ccr2 T G 9: 124,106,124 L147R probably damaging Het
Cfap61 T A 2: 145,951,050 probably null Het
Clk3 A T 9: 57,761,849 Y31N probably damaging Het
Cmya5 T C 13: 93,095,136 Y1148C probably benign Het
Cntnap5b T C 1: 100,383,450 V927A probably benign Het
Dync1i1 A C 6: 5,913,333 T217P probably damaging Het
Elovl4 A G 9: 83,785,100 V68A probably damaging Het
Ep400 C A 5: 110,665,862 K2890N probably damaging Het
Fam114a2 T C 11: 57,484,071 I481V probably benign Het
Fam83e A G 7: 45,722,394 T72A probably benign Het
Fnip2 A T 3: 79,518,111 M59K probably benign Het
Lrpprc T C 17: 84,722,703 K1089R probably benign Het
Mndal T A 1: 173,875,683 E52V probably damaging Het
Myom1 C A 17: 71,052,671 T446K probably damaging Het
Nbea A T 3: 55,723,610 F2199I possibly damaging Het
Nr1h2 A T 7: 44,550,013 L438Q probably damaging Het
Olfr668 A G 7: 104,925,123 C214R probably benign Het
Pet117 T A 2: 144,369,099 V13E possibly damaging Het
Pnpla8 A G 12: 44,283,427 E254G probably benign Het
Polr2a C T 11: 69,739,467 R1258Q probably benign Het
Polr2a T C 11: 69,736,177 E1485G probably damaging Het
Ptpn4 T C 1: 119,773,148 probably benign Het
Rapgef2 A T 3: 79,085,959 Y889N probably damaging Het
Sbf1 G A 15: 89,300,369 R1115C probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shank2 A T 7: 144,091,778 T366S probably benign Het
Slc22a23 T C 13: 34,305,180 I241V probably benign Het
Sox11 G T 12: 27,341,494 S305R probably damaging Het
Sox21 T C 14: 118,235,313 H108R possibly damaging Het
Taok1 A T 11: 77,555,653 S417T probably benign Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Traf3 T C 12: 111,255,224 V273A possibly damaging Het
Tspyl3 T C 2: 153,225,283 T12A probably benign Het
Vmn2r86 A T 10: 130,446,257 I830N probably damaging Het
Vps26b A T 9: 27,015,317 F129I possibly damaging Het
Washc3 A G 10: 88,201,852 N24S probably damaging Het
Xirp2 C A 2: 67,514,857 Q2481K probably benign Het
Zfhx4 T C 3: 5,412,987 V3554A probably damaging Het
Other mutations in Cdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cdc40 APN 10 40843128 missense probably damaging 1.00
IGL02333:Cdc40 APN 10 40867859 missense probably benign 0.00
IGL02490:Cdc40 APN 10 40841771 missense probably benign 0.39
IGL02878:Cdc40 APN 10 40843122 missense probably damaging 0.96
IGL02976:Cdc40 APN 10 40882921 missense probably benign
IGL03058:Cdc40 APN 10 40849828 missense probably benign 0.01
IGL03178:Cdc40 APN 10 40847989 missense probably benign
R0409:Cdc40 UTSW 10 40847168 missense probably damaging 0.99
R0522:Cdc40 UTSW 10 40857612 missense probably benign 0.21
R0608:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R0730:Cdc40 UTSW 10 40844956 splice site probably benign
R1712:Cdc40 UTSW 10 40841376 missense probably damaging 1.00
R1940:Cdc40 UTSW 10 40883071 unclassified probably benign
R4062:Cdc40 UTSW 10 40849852 splice site probably null
R5035:Cdc40 UTSW 10 40849813 missense probably benign 0.18
R5628:Cdc40 UTSW 10 40851053 missense probably benign 0.03
R7082:Cdc40 UTSW 10 40867873 missense probably benign
R7419:Cdc40 UTSW 10 40841443 missense probably damaging 1.00
R7625:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R7834:Cdc40 UTSW 10 40882949 missense probably benign 0.00
R7908:Cdc40 UTSW 10 40848046 missense probably damaging 1.00
R8031:Cdc40 UTSW 10 40852516 missense probably benign 0.00
R8131:Cdc40 UTSW 10 40841477 missense possibly damaging 0.45
RF041:Cdc40 UTSW 10 40843123 missense probably damaging 1.00
X0026:Cdc40 UTSW 10 40841452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAGATTGACTCCTTCCCG -3'
(R):5'- GCAAACTAGGCCGGGTTTAG -3'

Sequencing Primer
(F):5'- GATTGACTCCTTCCCGGCTCAG -3'
(R):5'- AGTGTACACAAGGTCCAG -3'
Posted On2018-11-06