Incidental Mutation 'R6977:Gm11232'
ID542496
Institutional Source Beutler Lab
Gene Symbol Gm11232
Ensembl Gene ENSMUSG00000066141
Gene Namepredicted gene 11232
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location71755643-71757965 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 71757941 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081532 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000084489
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Gm11232
AlleleSourceChrCoordTypePredicted EffectPPH Score
hint UTSW 4 71757213 nonsense probably null
suggestion UTSW 4 71756901 missense possibly damaging 0.82
R0062:Gm11232 UTSW 4 71756875 missense possibly damaging 0.46
R0062:Gm11232 UTSW 4 71756875 missense possibly damaging 0.46
R1457:Gm11232 UTSW 4 71756919 critical splice acceptor site probably null
R1458:Gm11232 UTSW 4 71757213 nonsense probably null
R1594:Gm11232 UTSW 4 71757335 missense possibly damaging 0.82
R2566:Gm11232 UTSW 4 71757785 missense probably benign 0.00
R4983:Gm11232 UTSW 4 71756901 missense possibly damaging 0.82
R6020:Gm11232 UTSW 4 71756668 missense possibly damaging 0.66
R7375:Gm11232 UTSW 4 71757346 nonsense probably null
R7772:Gm11232 UTSW 4 71756581 missense possibly damaging 0.52
R8523:Gm11232 UTSW 4 71757228 missense probably benign 0.27
T0970:Gm11232 UTSW 4 71756503 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCCAAGCCCATCAGTAGTTTAAAG -3'
(R):5'- AGATTGAAGTTAGCCGCCCC -3'

Sequencing Primer
(F):5'- ACTTGGAACTCCTGCCAGTG -3'
(R):5'- CCTCCCCTCCCTTTATTGAAG -3'
Posted On2018-11-28