Incidental Mutation 'PIT4260001:Myl6b'
ID554508
Institutional Source Beutler Lab
Gene Symbol Myl6b
Ensembl Gene ENSMUSG00000039824
Gene Namemyosin, light polypeptide 6B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #PIT4260001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128494157-128498685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128496306 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 97 (Q97L)
Ref Sequence ENSEMBL: ENSMUSP00000026428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026428] [ENSMUST00000164181] [ENSMUST00000217733] [ENSMUST00000217776] [ENSMUST00000217969] [ENSMUST00000218127] [ENSMUST00000219236] [ENSMUST00000220307] [ENSMUST00000220427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026428
AA Change: Q97L

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026428
Gene: ENSMUSG00000039824
AA Change: Q97L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
EFh 67 95 5.08e-3 SMART
EFh 144 172 6.38e0 SMART
Blast:EFh 179 207 9e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164181
SMART Domains Protein: ENSMUSP00000128803
Gene: ENSMUSG00000090841

DomainStartEndE-ValueType
EFh 11 39 8.98e-4 SMART
EFh 88 116 3.64e1 SMART
EFh 123 151 6.63e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217733
Predicted Effect probably benign
Transcript: ENSMUST00000217776
Predicted Effect probably benign
Transcript: ENSMUST00000217969
Predicted Effect probably benign
Transcript: ENSMUST00000218127
Predicted Effect probably benign
Transcript: ENSMUST00000219236
Predicted Effect probably benign
Transcript: ENSMUST00000220307
Predicted Effect probably benign
Transcript: ENSMUST00000220427
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 37,996,895 L71Q probably benign Het
Atp10a A T 7: 58,791,118 K504* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
Cep128 A G 12: 91,299,034 V268A probably benign Het
Clgn T C 8: 83,423,124 M418T probably damaging Het
Col12a1 A G 9: 79,651,380 probably null Het
Col4a3 A T 1: 82,682,761 E933D unknown Het
Csmd1 A T 8: 16,070,313 L1826Q probably damaging Het
Enpp2 C T 15: 54,844,378 probably null Het
Ep400 G A 5: 110,693,171 R1832* probably null Het
Exoc5 T C 14: 49,048,765 K135R probably benign Het
Fam83h A G 15: 76,001,897 F1197S probably damaging Het
Gabrg1 T C 5: 70,782,280 I170V probably benign Het
Gigyf2 C T 1: 87,419,106 R610C unknown Het
Gm16440 T C 14: 6,388,301 E119G probably benign Het
Gm17669 A G 18: 67,562,438 R18G probably damaging Het
Gxylt1 A G 15: 93,261,827 S100P probably damaging Het
Hacd4 C G 4: 88,398,105 R259T unknown Het
Hacd4 T A 4: 88,398,106 R259* probably null Het
Hist1h3h C A 13: 21,717,919 S87R possibly damaging Het
Hivep3 T C 4: 120,099,182 L1565P probably damaging Het
Iqsec1 T A 6: 90,690,489 D218V probably damaging Het
Matn2 C T 15: 34,428,731 T747I possibly damaging Het
Olfr73 A T 2: 88,034,782 M119K probably damaging Het
Pcdh1 A G 18: 38,203,366 V72A probably damaging Het
Pira2 C T 7: 3,842,170 S363N probably benign Het
Pira2 G C 7: 3,842,173 T362S probably benign Het
Pira2 T C 7: 3,842,174 T362A probably benign Het
Pkhd1 A G 1: 20,222,906 V2830A possibly damaging Het
Plpp1 A G 13: 112,856,885 D118G probably damaging Het
Polr2a A G 11: 69,735,967 S1514P possibly damaging Het
Pou3f2 G T 4: 22,487,291 Q281K possibly damaging Het
Prl7a2 A T 13: 27,659,276 Y181* probably null Het
Prpf4b T A 13: 34,884,291 S368T probably benign Het
Prss45 A G 9: 110,838,445 D53G probably benign Het
Ryr2 T A 13: 11,594,755 H4395L possibly damaging Het
Spp2 G T 1: 88,411,205 A97S probably benign Het
Strn4 T C 7: 16,822,509 F99S probably damaging Het
Tcaf2 T A 6: 42,642,805 H96L probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Trpm6 A T 19: 18,825,802 M870L possibly damaging Het
Ttn T C 2: 76,943,225 T2351A unknown Het
Xirp2 T A 2: 67,511,597 I1394K possibly damaging Het
Zfc3h1 G T 10: 115,390,889 D284Y probably damaging Het
Other mutations in Myl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Myl6b APN 10 128496342 missense possibly damaging 0.54
IGL02257:Myl6b APN 10 128497341 unclassified probably benign
R1971:Myl6b UTSW 10 128494643 missense probably damaging 0.98
R5476:Myl6b UTSW 10 128497347 unclassified probably benign
R6361:Myl6b UTSW 10 128497209 nonsense probably null
R7149:Myl6b UTSW 10 128497199 critical splice donor site probably null
R7540:Myl6b UTSW 10 128496280 nonsense probably null
R8221:Myl6b UTSW 10 128497340 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCAACCTGAGTAATTTGG -3'
(R):5'- CATGAATTTCTGAAGCAAACCTCC -3'

Sequencing Primer
(F):5'- CAGTACCTCTGTAATAAGGGCTTGC -3'
(R):5'- GAATTTCTGAAGCAAACCTCCCTCTC -3'
Posted On2019-06-07