Incidental Mutation 'PIT4260001:Atp10a'
ID554501
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene NameATPase, class V, type 10A
SynonymsAtp10c, pfatp
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #PIT4260001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location58656166-58829420 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58791118 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 504 (K504*)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747]
Predicted Effect probably null
Transcript: ENSMUST00000168747
AA Change: K504*
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: K504*

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 37,996,895 L71Q probably benign Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
Cep128 A G 12: 91,299,034 V268A probably benign Het
Clgn T C 8: 83,423,124 M418T probably damaging Het
Col12a1 A G 9: 79,651,380 probably null Het
Col4a3 A T 1: 82,682,761 E933D unknown Het
Csmd1 A T 8: 16,070,313 L1826Q probably damaging Het
Enpp2 C T 15: 54,844,378 probably null Het
Ep400 G A 5: 110,693,171 R1832* probably null Het
Exoc5 T C 14: 49,048,765 K135R probably benign Het
Fam83h A G 15: 76,001,897 F1197S probably damaging Het
Gabrg1 T C 5: 70,782,280 I170V probably benign Het
Gigyf2 C T 1: 87,419,106 R610C unknown Het
Gm16440 T C 14: 6,388,301 E119G probably benign Het
Gm17669 A G 18: 67,562,438 R18G probably damaging Het
Gxylt1 A G 15: 93,261,827 S100P probably damaging Het
Hacd4 C G 4: 88,398,105 R259T unknown Het
Hacd4 T A 4: 88,398,106 R259* probably null Het
Hist1h3h C A 13: 21,717,919 S87R possibly damaging Het
Hivep3 T C 4: 120,099,182 L1565P probably damaging Het
Iqsec1 T A 6: 90,690,489 D218V probably damaging Het
Matn2 C T 15: 34,428,731 T747I possibly damaging Het
Myl6b T A 10: 128,496,306 Q97L possibly damaging Het
Olfr73 A T 2: 88,034,782 M119K probably damaging Het
Pcdh1 A G 18: 38,203,366 V72A probably damaging Het
Pira2 C T 7: 3,842,170 S363N probably benign Het
Pira2 G C 7: 3,842,173 T362S probably benign Het
Pira2 T C 7: 3,842,174 T362A probably benign Het
Pkhd1 A G 1: 20,222,906 V2830A possibly damaging Het
Plpp1 A G 13: 112,856,885 D118G probably damaging Het
Polr2a A G 11: 69,735,967 S1514P possibly damaging Het
Pou3f2 G T 4: 22,487,291 Q281K possibly damaging Het
Prl7a2 A T 13: 27,659,276 Y181* probably null Het
Prpf4b T A 13: 34,884,291 S368T probably benign Het
Prss45 A G 9: 110,838,445 D53G probably benign Het
Ryr2 T A 13: 11,594,755 H4395L possibly damaging Het
Spp2 G T 1: 88,411,205 A97S probably benign Het
Strn4 T C 7: 16,822,509 F99S probably damaging Het
Tcaf2 T A 6: 42,642,805 H96L probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Trpm6 A T 19: 18,825,802 M870L possibly damaging Het
Ttn T C 2: 76,943,225 T2351A unknown Het
Xirp2 T A 2: 67,511,597 I1394K possibly damaging Het
Zfc3h1 G T 10: 115,390,889 D284Y probably damaging Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7903:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R7944:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7986:Atp10a UTSW 7 58658822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCTGAATTAATTCCGTCTGC -3'
(R):5'- GAAATCTTCTGTGCCTGGAGC -3'

Sequencing Primer
(F):5'- GCCCCCATTGATGTCTAACATTTTG -3'
(R):5'- GAGCACAGCCAAGCCTGAG -3'
Posted On2019-06-07