Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4260001:Atp10a'

554501

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

PIT4260001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 58791118 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 504 (K504*)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably null
Transcript: ENSMUST00000168747
AA Change: K504*

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: K504*

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 92.7%
3x: 90.5%
10x: 84.8%
20x: 72.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	A	T	18: 37,996,895	L71Q	probably benign	Het
AW551984	T	C	9: 39,592,979	T564A	probably benign	Het
Cep128	A	G	12: 91,299,034	V268A	probably benign	Het
Clgn	T	C	8: 83,423,124	M418T	probably damaging	Het
Col12a1	A	G	9: 79,651,380		probably null	Het
Col4a3	A	T	1: 82,682,761	E933D	unknown	Het
Csmd1	A	T	8: 16,070,313	L1826Q	probably damaging	Het
Enpp2	C	T	15: 54,844,378		probably null	Het
Ep400	G	A	5: 110,693,171	R1832*	probably null	Het
Exoc5	T	C	14: 49,048,765	K135R	probably benign	Het
Fam83h	A	G	15: 76,001,897	F1197S	probably damaging	Het
Gabrg1	T	C	5: 70,782,280	I170V	probably benign	Het
Gigyf2	C	T	1: 87,419,106	R610C	unknown	Het
Gm16440	T	C	14: 6,388,301	E119G	probably benign	Het
Gm17669	A	G	18: 67,562,438	R18G	probably damaging	Het
Gxylt1	A	G	15: 93,261,827	S100P	probably damaging	Het
Hacd4	C	G	4: 88,398,105	R259T	unknown	Het
Hacd4	T	A	4: 88,398,106	R259*	probably null	Het
Hist1h3h	C	A	13: 21,717,919	S87R	possibly damaging	Het
Hivep3	T	C	4: 120,099,182	L1565P	probably damaging	Het
Iqsec1	T	A	6: 90,690,489	D218V	probably damaging	Het
Matn2	C	T	15: 34,428,731	T747I	possibly damaging	Het
Myl6b	T	A	10: 128,496,306	Q97L	possibly damaging	Het
Olfr73	A	T	2: 88,034,782	M119K	probably damaging	Het
Pcdh1	A	G	18: 38,203,366	V72A	probably damaging	Het
Pira2	C	T	7: 3,842,170	S363N	probably benign	Het
Pira2	G	C	7: 3,842,173	T362S	probably benign	Het
Pira2	T	C	7: 3,842,174	T362A	probably benign	Het
Pkhd1	A	G	1: 20,222,906	V2830A	possibly damaging	Het
Plpp1	A	G	13: 112,856,885	D118G	probably damaging	Het
Polr2a	A	G	11: 69,735,967	S1514P	possibly damaging	Het
Pou3f2	G	T	4: 22,487,291	Q281K	possibly damaging	Het
Prl7a2	A	T	13: 27,659,276	Y181*	probably null	Het
Prpf4b	T	A	13: 34,884,291	S368T	probably benign	Het
Prss45	A	G	9: 110,838,445	D53G	probably benign	Het
Ryr2	T	A	13: 11,594,755	H4395L	possibly damaging	Het
Spp2	G	T	1: 88,411,205	A97S	probably benign	Het
Strn4	T	C	7: 16,822,509	F99S	probably damaging	Het
Tcaf2	T	A	6: 42,642,805	H96L	probably damaging	Het
Tenm2	T	C	11: 36,163,730	D601G	probably damaging	Het
Trpm6	A	T	19: 18,825,802	M870L	possibly damaging	Het
Ttn	T	C	2: 76,943,225	T2351A	unknown	Het
Xirp2	T	A	2: 67,511,597	I1394K	possibly damaging	Het
Zfc3h1	G	T	10: 115,390,889	D284Y	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACATCCTGAATTAATTCCGTCTGC -3'
(R):5'- GAAATCTTCTGTGCCTGGAGC -3'

Sequencing Primer
(F):5'- GCCCCCATTGATGTCTAACATTTTG -3'
(R):5'- GAGCACAGCCAAGCCTGAG -3'

Posted On

2019-06-07