Incidental Mutation 'R7187:Fgf8'
ID559396
Institutional Source Beutler Lab
Gene Symbol Fgf8
Ensembl Gene ENSMUSG00000025219
Gene Namefibroblast growth factor 8
SynonymsAigf, Fgf-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7187 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45736798-45742915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45741667 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000026240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026240] [ENSMUST00000026241] [ENSMUST00000111924] [ENSMUST00000111925] [ENSMUST00000111927] [ENSMUST00000111928]
Predicted Effect probably benign
Transcript: ENSMUST00000026240
AA Change: S57P

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026240
Gene: ENSMUSG00000025219
AA Change: S57P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 49 58 N/A INTRINSIC
FGF 79 207 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026241
SMART Domains Protein: ENSMUSP00000026241
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 103 231 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111924
SMART Domains Protein: ENSMUSP00000107555
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
FGF 1 103 1.56e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111925
SMART Domains Protein: ENSMUSP00000107556
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 68 196 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111927
SMART Domains Protein: ENSMUSP00000107558
Gene: ENSMUSG00000025219

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 39 167 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111928
AA Change: S28P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107559
Gene: ENSMUSG00000025219
AA Change: S28P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 50 178 1.22e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit cardiovascular defects (including abnormal left-right axis determination), impaired limb, thymic, and craniofacial development, and prenatal or early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,437,721 Y716C probably damaging Het
Abcc1 A G 16: 14,466,997 I1237V probably benign Het
Adam34 C T 8: 43,652,528 A27T probably benign Het
Aff3 T C 1: 38,218,397 S415G probably damaging Het
Ak7 T C 12: 105,745,273 Y390H probably benign Het
Arap2 A C 5: 62,669,053 M1056R probably damaging Het
Brf1 T C 12: 112,960,325 Y676C unknown Het
Cachd1 T A 4: 100,976,355 H776Q possibly damaging Het
Cacng7 T C 7: 3,336,667 V28A probably damaging Het
Camk2g A T 14: 20,742,712 D359E probably benign Het
Cd209b T C 8: 3,926,638 D16G probably benign Het
Ceacam5 A G 7: 17,759,485 E811G possibly damaging Het
Cecr2 T A 6: 120,756,686 S545T probably benign Het
Cep55 T C 19: 38,060,358 probably null Het
Ctif C A 18: 75,637,219 V32L probably damaging Het
Cwc27 G A 13: 104,661,392 A353V probably benign Het
Dclk3 T A 9: 111,484,996 S713R probably damaging Het
Dlec1 C T 9: 119,112,146 H255Y probably benign Het
Dlgap1 A G 17: 70,516,098 H26R possibly damaging Het
Dydc1 C T 14: 41,078,094 T19I possibly damaging Het
Efcab12 G A 6: 115,823,513 P183L not run Het
Eri3 C A 4: 117,589,146 Q219K probably benign Het
Fam135a A G 1: 24,044,214 L310P probably damaging Het
Fgd5 T A 6: 91,988,291 S502T possibly damaging Het
Gls T C 1: 52,219,980 E154G probably damaging Het
Gm21319 T C 12: 87,773,938 probably benign Het
Gm28042 T C 2: 120,039,695 L705P probably damaging Het
Golgb1 C A 16: 36,916,150 Q1961K probably benign Het
Herc3 C A 6: 58,856,631 Q168K probably benign Het
Il31ra C A 13: 112,546,311 C168F probably benign Het
Ino80 A T 2: 119,426,591 D860E probably benign Het
Iqcm T G 8: 75,753,416 L334R probably benign Het
Lrrk2 A G 15: 91,757,001 D1587G possibly damaging Het
Map4 T A 9: 110,053,133 V355E probably benign Het
Mapk13 T A 17: 28,776,387 I194N probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Naglu G T 11: 101,070,332 G70W probably benign Het
Nlrp4f A T 13: 65,195,387 M126K possibly damaging Het
Olfr1225 T C 2: 89,171,370 probably benign Het
Olfr485 A T 7: 108,159,378 V165E probably benign Het
Pdia4 T C 6: 47,813,259 T16A unknown Het
Pou6f2 G A 13: 18,239,713 A159V Het
Ripor1 A G 8: 105,617,874 T547A probably benign Het
Rundc3b A G 5: 8,492,506 S389P probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats2 T C 15: 99,212,173 S484P probably benign Het
Supv3l1 G A 10: 62,435,549 T403I probably damaging Het
Tacstd2 G A 6: 67,535,196 R171W probably damaging Het
Taok2 A T 7: 126,872,380 F542L probably damaging Het
Tbc1d31 T A 15: 57,938,063 N331K possibly damaging Het
Tff2 A T 17: 31,142,226 C118S probably damaging Het
Tmprss7 G A 16: 45,677,954 T354I possibly damaging Het
Tmtc3 A T 10: 100,477,912 F33I probably damaging Het
Tpbpa G A 13: 60,940,585 probably benign Het
Ube3a G T 7: 59,275,905 V165F probably benign Het
Vmn2r4 T G 3: 64,415,260 T13P probably benign Het
Wnt8b A G 19: 44,511,682 D236G probably benign Het
Ythdf3 C A 3: 16,204,287 D210E probably benign Het
Zfp110 T A 7: 12,849,826 Y800* probably null Het
Other mutations in Fgf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Fgf8 APN 19 45737216 missense probably damaging 1.00
IGL02282:Fgf8 APN 19 45737090 missense possibly damaging 0.72
IGL03083:Fgf8 APN 19 45737228 missense probably damaging 1.00
R1499:Fgf8 UTSW 19 45742347 missense possibly damaging 0.46
R1967:Fgf8 UTSW 19 45741568 missense probably damaging 1.00
R4603:Fgf8 UTSW 19 45738153 missense probably benign 0.22
R5621:Fgf8 UTSW 19 45742382 missense probably benign 0.05
R7831:Fgf8 UTSW 19 45742437 missense probably benign 0.00
R8032:Fgf8 UTSW 19 45737237 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAATGCACCTTACCGAAG -3'
(R):5'- GGGTTCATCCATCCATCCTG -3'

Sequencing Primer
(F):5'- AAGGGGTCTCCGTCTTCTGC -3'
(R):5'- ATCCATCCATCCTGGGCTGG -3'
Posted On2019-06-26