Incidental Mutation 'R7542:Mcph1'
ID583950
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Namemicrocephaly, primary autosomal recessive 1
SynonymsBRIT1, D030046N04Rik, 5430437K10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7542 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location18595131-18803189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18631689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 281 (R281C)
Ref Sequence ENSEMBL: ENSMUSP00000037000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910] [ENSMUST00000133417] [ENSMUST00000141244] [ENSMUST00000146819]
Predicted Effect probably benign
Transcript: ENSMUST00000039412
AA Change: R281C

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842
AA Change: R281C

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133417
AA Change: R193C

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121636
Gene: ENSMUSG00000039842
AA Change: R193C

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
Pfam:Microcephalin 136 256 2.4e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146819
AA Change: R281C

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131616
Gene: ENSMUSG00000039842
AA Change: R281C

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 598 1.4e-168 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adam24 A T 8: 40,680,809 T439S possibly damaging Het
AF529169 T A 9: 89,601,911 T478S probably damaging Het
Akap11 A T 14: 78,510,292 S1552T Het
Akap6 A G 12: 53,069,234 E1040G probably damaging Het
Alms1 A T 6: 85,629,362 T2196S possibly damaging Het
Alox12e T C 11: 70,321,756 Q89R possibly damaging Het
AW551984 T A 9: 39,594,631 E423D possibly damaging Het
Ccpg1 T A 9: 73,012,459 V452D probably damaging Het
Cdk5r1 T C 11: 80,478,364 F286L probably damaging Het
Cgref1 A T 5: 30,933,593 N292K probably damaging Het
Clgn A T 8: 83,395,545 S32C possibly damaging Het
Csk C A 9: 57,629,000 probably null Het
Dchs2 A G 3: 83,269,284 T850A probably benign Het
Defb2 T C 8: 21,843,344 V45A probably benign Het
Disp2 A G 2: 118,791,118 Q777R probably damaging Het
Dll1 C T 17: 15,370,347 C369Y probably damaging Het
Dnah7c A G 1: 46,784,498 I3766V probably benign Het
Fam53a A G 5: 33,607,471 M297T probably damaging Het
Fat4 A G 3: 38,981,355 D3052G possibly damaging Het
Fat4 A T 3: 38,981,621 I3141F possibly damaging Het
Fbxw10 T C 11: 62,850,596 V180A probably benign Het
Frem2 A T 3: 53,652,579 D1502E probably damaging Het
Fsip2 A T 2: 82,984,852 N3643I possibly damaging Het
Furin A G 7: 80,393,459 S335P probably damaging Het
Glb1l3 C A 9: 26,818,195 A659S possibly damaging Het
Gm16486 A G 8: 70,708,766 T203A possibly damaging Het
Gm8011 A T 14: 42,466,784 R175* probably null Het
Gna15 A G 10: 81,514,302 S89P probably damaging Het
Grm2 A T 9: 106,651,169 L172Q probably damaging Het
Kcnc3 A G 7: 44,595,714 D476G possibly damaging Het
Kcnh6 A G 11: 106,014,561 T216A possibly damaging Het
Kdm2a G A 19: 4,333,830 probably benign Het
Lrrc9 T C 12: 72,506,320 I1332T probably damaging Het
Maea T C 5: 33,371,663 C317R probably damaging Het
Manba T C 3: 135,566,593 V707A probably benign Het
Med25 A T 7: 44,891,791 D99E probably damaging Het
Megf10 C A 18: 57,189,570 D62E probably benign Het
Myod1 A T 7: 46,376,673 M1L probably benign Het
Nav3 A T 10: 109,823,533 M741K possibly damaging Het
Odf2l A C 3: 145,153,436 K618T probably damaging Het
Olfr1212 A T 2: 88,958,775 E103V probably benign Het
Pcdha2 G A 18: 36,940,089 G258R probably damaging Het
Pcdha3 G A 18: 36,947,731 A509T possibly damaging Het
Pde4dip A G 3: 97,766,655 V315A possibly damaging Het
Prim1 T C 10: 128,018,034 V107A probably damaging Het
Pxdc1 A G 13: 34,638,163 probably null Het
Rab7b C T 1: 131,711,641 H182Y probably benign Het
Reln C A 5: 21,955,181 G2130V probably damaging Het
Retreg1 T A 15: 25,941,210 M1K probably null Het
Rras G A 7: 45,020,342 R94Q probably damaging Het
Rundc3a T A 11: 102,400,045 L318Q probably benign Het
Scgb2b18 A T 7: 33,173,322 probably null Het
Setd1b A T 5: 123,148,447 M519L unknown Het
Tep1 G A 14: 50,862,491 Q426* probably null Het
Tesk1 G T 4: 43,445,941 M291I probably benign Het
Tgs1 A G 4: 3,595,439 D536G probably benign Het
Thbs1 C T 2: 118,121,174 T825M probably damaging Het
Tmem59l T C 8: 70,485,164 N189D possibly damaging Het
Trim30c A T 7: 104,382,218 D463E possibly damaging Het
Trpc4 A G 3: 54,315,654 Y706C probably damaging Het
Ttc13 A T 8: 124,675,103 probably null Het
Tulp1 T C 17: 28,363,755 K140E probably benign Het
Urb2 A G 8: 124,028,588 I345V probably benign Het
Vmn2r43 T C 7: 8,255,489 M242V probably benign Het
Zcwpw1 T C 5: 137,819,523 V509A probably benign Het
Zfp202 T C 9: 40,211,147 C402R probably benign Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18632620 missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18632397 missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18625639 missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18631519 missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18671127 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632403 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632404 missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18668990 splice site probably benign
IGL02677:Mcph1 APN 8 18625593 missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18596973 missense probably damaging 0.99
PIT4514001:Mcph1 UTSW 8 18631890 missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18788248 missense probably benign 0.06
R0189:Mcph1 UTSW 8 18788471 missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18632687 intron probably null
R1547:Mcph1 UTSW 8 18622686 missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18631963 missense probably benign 0.18
R1742:Mcph1 UTSW 8 18607363 missense probably benign 0.03
R1975:Mcph1 UTSW 8 18689065 splice site probably benign
R3836:Mcph1 UTSW 8 18622659 missense possibly damaging 0.91
R4405:Mcph1 UTSW 8 18632541 missense probably benign 0.00
R4493:Mcph1 UTSW 8 18631736 nonsense probably null
R4824:Mcph1 UTSW 8 18632687 intron probably null
R4873:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18788473 missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18671238 missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18652580 intron probably benign
R5335:Mcph1 UTSW 8 18689061 critical splice donor site probably null
R5579:Mcph1 UTSW 8 18632293 missense probably benign 0.18
R5621:Mcph1 UTSW 8 18632170 missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18788310 missense probably benign 0.02
R5721:Mcph1 UTSW 8 18671207 missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18631999 missense probably benign 0.40
R6592:Mcph1 UTSW 8 18668967 missense probably damaging 0.97
R7269:Mcph1 UTSW 8 18607272 splice site probably null
R7446:Mcph1 UTSW 8 18671093 missense probably benign 0.00
R7455:Mcph1 UTSW 8 18631759 missense probably benign 0.26
R7640:Mcph1 UTSW 8 18632326 missense probably benign 0.00
R7703:Mcph1 UTSW 8 18671106 missense possibly damaging 0.82
RF002:Mcph1 UTSW 8 18652529 small insertion probably benign
RF035:Mcph1 UTSW 8 18652525 small insertion probably benign
RF059:Mcph1 UTSW 8 18652525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCGATTCTTTGTTGATCTC -3'
(R):5'- GCAGAAGAATTCTTGGGTCCC -3'

Sequencing Primer
(F):5'- CTGCAGATGAATCCTTTGCCAGTG -3'
(R):5'- GAAGAATTCTTGGGTCCCAACCG -3'
Posted On2019-10-17