Incidental Mutation 'R7623:Hdhd5'
ID589250
Institutional Source Beutler Lab
Gene Symbol Hdhd5
Ensembl Gene ENSMUSG00000058979
Gene Namehaloacid dehalogenase like hydrolase domain containing 5
SynonymsCecr5, A930002G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7623 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location120509494-120531319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120521251 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 129 (Y129C)
Ref Sequence ENSEMBL: ENSMUSP00000074775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075303]
Predicted Effect probably damaging
Transcript: ENSMUST00000075303
AA Change: Y129C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074775
Gene: ENSMUSG00000058979
AA Change: Y129C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Hydrolase_6 49 152 2e-22 PFAM
Pfam:Hydrolase_like 275 351 3.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik G T 16: 21,694,342 L22M probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
5430419D17Rik T A 7: 131,277,566 probably null Het
Abca9 T C 11: 110,107,558 N1468S probably benign Het
Abcc5 C T 16: 20,344,696 D1264N possibly damaging Het
Abhd10 A G 16: 45,732,736 probably benign Het
Acadvl G T 11: 70,010,743 A570E probably damaging Het
Adgrb3 T A 1: 25,547,548 S355C probably damaging Het
Adgrv1 A G 13: 81,422,225 V4953A possibly damaging Het
Ano2 T A 6: 126,015,573 Y836* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc8 T A 7: 16,996,612 D675E possibly damaging Het
Ccnb2 A G 9: 70,418,888 V58A probably benign Het
Cdh24 A T 14: 54,638,090 Y296N probably damaging Het
Cfap46 T C 7: 139,618,350 E2054G unknown Het
Cnot1 A T 8: 95,727,648 F2067I probably damaging Het
Csmd3 A G 15: 47,949,938 F329S Het
Dact3 C A 7: 16,885,915 T445K unknown Het
Dph6 C A 2: 114,654,898 probably benign Het
Dst T A 1: 34,170,436 C1195S probably damaging Het
Fam102a A G 2: 32,566,334 D336G possibly damaging Het
Fat3 T A 9: 15,988,324 N3138Y probably damaging Het
Fbxw25 T C 9: 109,654,583 N187S Het
Fuca1 A G 4: 135,933,094 I308V probably benign Het
Galnt5 A G 2: 58,017,210 R562G probably damaging Het
Gas8 G T 8: 123,522,979 R44S probably damaging Het
Gja5 T C 3: 97,050,755 S43P possibly damaging Het
Gm14403 A G 2: 177,508,612 D117G probably benign Het
Gmpr2 G A 14: 55,673,034 V58M probably damaging Het
Gtpbp6 T A 5: 110,105,084 I301F probably damaging Het
Hemgn A G 4: 46,396,504 M244T probably benign Het
Hist1h2bp T A 13: 21,787,592 D26E probably benign Het
Hoxa1 T G 6: 52,158,258 probably null Het
Iglc1 T A 16: 19,061,801 H90L Het
Lamb2 C T 9: 108,489,224 S1545F possibly damaging Het
Mc4r T C 18: 66,859,509 T178A probably benign Het
Mcam T A 9: 44,139,658 S346T probably benign Het
Mis18bp1 A G 12: 65,148,852 S713P probably benign Het
Mybl2 A G 2: 163,072,832 Y290C probably damaging Het
Olfr1294 T C 2: 111,537,936 M118V probably damaging Het
Olfr859 A T 9: 19,808,929 I204F possibly damaging Het
Pak6 A G 2: 118,694,587 T565A probably damaging Het
Pde5a A G 3: 122,774,601 T284A probably benign Het
Pkd1l2 A T 8: 117,029,645 F1616Y probably damaging Het
Pp2d1 T C 17: 53,515,879 E53G probably benign Het
Ppp3cc A C 14: 70,240,945 S269R probably benign Het
Ptprb A C 10: 116,369,309 D1856A possibly damaging Het
Rgs22 A T 15: 36,040,710 V1001E probably benign Het
Rnf8 T A 17: 29,629,006 V344E probably benign Het
Rpn1 T C 6: 88,084,568 L13P possibly damaging Het
Rsbn1 A T 3: 103,915,010 H187L probably benign Het
Sdr16c6 T A 4: 4,058,801 I262F not run Het
Sec22a A G 16: 35,329,524 F211L probably benign Het
Slc16a4 G A 3: 107,297,981 A42T possibly damaging Het
Smap1 T A 1: 23,848,295 Q386L probably benign Het
Sos1 A T 17: 80,479,894 F10L probably benign Het
Sptbn2 A G 19: 4,726,168 T202A probably damaging Het
Stab1 C A 14: 31,140,621 V2282L probably benign Het
Tmprss11f C T 5: 86,524,160 G391D probably damaging Het
Tnfaip2 A G 12: 111,445,638 S158G probably damaging Het
Trav6d-5 A G 14: 52,795,386 T31A probably benign Het
Tst G A 15: 78,405,703 A44V probably damaging Het
Vmn1r210 A T 13: 22,827,235 F294I probably benign Het
Vwc2 T C 11: 11,116,415 F168L probably damaging Het
Wdr25 G A 12: 108,992,893 G344S possibly damaging Het
Zfp605 A G 5: 110,127,520 Y168C probably benign Het
Zfp790 T A 7: 29,825,705 Y49* probably null Het
Zfp93 T C 7: 24,276,369 F593S probably damaging Het
Zfr C T 15: 12,160,528 T729I possibly damaging Het
Other mutations in Hdhd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1499:Hdhd5 UTSW 6 120514512 missense probably damaging 0.98
R4795:Hdhd5 UTSW 6 120523446 missense probably benign
R5872:Hdhd5 UTSW 6 120510291 missense probably benign
R5878:Hdhd5 UTSW 6 120514524 missense probably damaging 1.00
R6295:Hdhd5 UTSW 6 120518524 missense probably benign 0.04
R6556:Hdhd5 UTSW 6 120523554 missense probably benign 0.00
R6815:Hdhd5 UTSW 6 120521209 missense probably benign 0.02
R6991:Hdhd5 UTSW 6 120510169 missense probably damaging 0.99
R7159:Hdhd5 UTSW 6 120523471 missense probably damaging 1.00
R7250:Hdhd5 UTSW 6 120517055 missense possibly damaging 0.93
R7538:Hdhd5 UTSW 6 120521296 missense possibly damaging 0.92
R7909:Hdhd5 UTSW 6 120531191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATCTGGGCACACGGTTCTG -3'
(R):5'- GCAAGTGCCAGATTGTTTACAATG -3'

Sequencing Primer
(F):5'- GGCTGTTACCACTAGTCTCAAGGAC -3'
(R):5'- GCTGTCACCCTATCATGT -3'
Posted On2019-10-24