Incidental Mutation 'R7750:Sppl2a'
ID597135
Institutional Source Beutler Lab
Gene Symbol Sppl2a
Ensembl Gene ENSMUSG00000027366
Gene Namesignal peptide peptidase like 2A
SynonymsC130089K23Rik, 2010106G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7750 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126890391-126933235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126919705 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 293 (L293P)
Ref Sequence ENSEMBL: ENSMUSP00000028844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028844]
Predicted Effect probably damaging
Transcript: ENSMUST00000028844
AA Change: L293P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366
AA Change: L293P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119064
Gene: ENSMUSG00000027366
AA Change: L21P

DomainStartEndE-ValueType
PSN 3 233 1.27e-60 SMART
Meta Mutation Damage Score 0.8646 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,075,200 D816V possibly damaging Het
Abca16 A T 7: 120,514,705 N933I probably benign Het
Acly A T 11: 100,478,013 probably null Het
Acox1 C T 11: 116,183,580 G105D possibly damaging Het
Ankrd24 A G 10: 81,646,794 E939G possibly damaging Het
Bard1 T A 1: 71,066,942 probably null Het
Brd4 G T 17: 32,213,547 N579K unknown Het
C1qc T C 4: 136,890,281 Y168C probably damaging Het
Casp6 A G 3: 129,912,209 D175G probably damaging Het
Ccdc83 A T 7: 90,223,982 Y388* probably null Het
Clasrp A T 7: 19,584,591 *628R probably null Het
Cox4i1 A G 8: 120,673,310 I111V probably benign Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Epb41l4b C T 4: 57,076,913 probably null Het
Frem2 C A 3: 53,523,682 L2743F possibly damaging Het
Frmd4a A T 2: 4,601,349 H628L probably benign Het
Fyb A G 15: 6,660,703 D809G probably damaging Het
Gm19410 T A 8: 35,807,498 M1491K possibly damaging Het
Gm3604 G A 13: 62,369,996 H183Y possibly damaging Het
H1fnt A G 15: 98,256,684 S195P unknown Het
Lama2 T C 10: 26,990,924 Y2858C probably damaging Het
Methig1 T C 15: 100,353,531 F108L probably benign Het
Mfsd4b5 A G 10: 39,970,255 V443A probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myh9 C T 15: 77,783,410 V608I probably benign Het
Myo1g T C 11: 6,514,849 D475G probably damaging Het
Neb A C 2: 52,280,716 probably null Het
Nlrp1b T A 11: 71,168,839 I769F probably benign Het
Nol8 G T 13: 49,662,266 V617F possibly damaging Het
Olfr715b A T 7: 107,106,533 C109* probably null Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pou3f3 T A 1: 42,698,148 F335I probably damaging Het
Ppp1r3e T C 14: 54,876,627 D196G probably damaging Het
Prpf40a T C 2: 53,151,745 T545A probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rprd1a T A 18: 24,508,254 K102* probably null Het
Sim1 A G 10: 50,896,035 T47A possibly damaging Het
Slc45a1 C T 4: 150,644,041 A102T probably damaging Het
Slc6a11 C T 6: 114,230,137 P361S possibly damaging Het
Slc9b2 T C 3: 135,326,237 F286S probably damaging Het
Slco4a1 T C 2: 180,471,237 S421P probably benign Het
Snap91 A C 9: 86,798,709 probably null Het
Sval3 T A 6: 41,972,426 I66K possibly damaging Het
Synj2bp T C 12: 81,504,537 I85V probably benign Het
Thop1 G T 10: 81,080,191 A403S probably benign Het
Timd4 T A 11: 46,815,527 M52K probably damaging Het
Tmco5b A G 2: 113,288,264 N111D probably damaging Het
Trip10 G A 17: 57,261,667 V419I possibly damaging Het
Trpv3 T C 11: 73,286,021 Y409H probably damaging Het
Tulp4 A G 17: 6,233,124 T1143A probably damaging Het
Ugt2b5 A T 5: 87,140,249 S20T probably benign Het
Unc5b A G 10: 60,775,044 F406L probably benign Het
Usf3 A G 16: 44,220,521 E1788G probably benign Het
Usp45 A G 4: 21,780,430 D27G probably damaging Het
Vmn2r100 G A 17: 19,522,464 V367I probably benign Het
Vmn2r49 T A 7: 9,976,258 K849I probably damaging Het
Zfp119b A T 17: 55,938,682 H501Q probably damaging Het
Zfp462 C A 4: 55,016,958 H893N probably benign Het
Zkscan4 A G 13: 21,479,355 E88G probably damaging Het
Other mutations in Sppl2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.04
IGL01471:Sppl2a APN 2 126917867 nonsense probably null
IGL01572:Sppl2a APN 2 126920312 splice site probably null
IGL01712:Sppl2a APN 2 126904903 splice site probably benign
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.68
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.07
abra UTSW 2 126923594 missense probably benign 0.00
abra2 UTSW 2 126920313 splice site probably null
isaac UTSW 2 126913575 missense probably damaging 1.00
jacob UTSW 2 126913281 splice site probably null
PIT4431001:Sppl2a UTSW 2 126923476 missense probably damaging 1.00
R0023:Sppl2a UTSW 2 126913293 splice site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 unclassified probably benign
R0799:Sppl2a UTSW 2 126920307 splice site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice site probably benign
R1669:Sppl2a UTSW 2 126917794 splice site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 splice site probably null
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
R6382:Sppl2a UTSW 2 126917029 splice site probably null
R6888:Sppl2a UTSW 2 126904992 missense probably damaging 0.99
R6892:Sppl2a UTSW 2 126913575 missense probably damaging 1.00
R7021:Sppl2a UTSW 2 126927743 splice site probably null
R8129:Sppl2a UTSW 2 126923470 missense probably damaging 1.00
R8136:Sppl2a UTSW 2 126913281 splice site probably null
R8772:Sppl2a UTSW 2 126926311 missense probably benign 0.16
RF016:Sppl2a UTSW 2 126927774 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCAACGGGGCTCATACAG -3'
(R):5'- GAGGCAGTTATTATGCCTCATTG -3'

Sequencing Primer
(F):5'- gctcatacagagatcctgtTAA -3'
(R):5'- TGCCTCATTGGTTTTATGTAAAAATC -3'
Posted On2019-11-26