Incidental Mutation 'RF062:Tnfaip8'
ID605447
Institutional Source Beutler Lab
Gene Symbol Tnfaip8
Ensembl Gene ENSMUSG00000062210
Gene Nametumor necrosis factor, alpha-induced protein 8
SynonymsE130304C20Rik, Ssc-2, Nded, Gg2-1, Gm10539
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #RF062 (G1)
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location49979427-50107173 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to AC at 50046831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126666] [ENSMUST00000128377] [ENSMUST00000134348] [ENSMUST00000145726] [ENSMUST00000148989] [ENSMUST00000153873] [ENSMUST00000179937] [ENSMUST00000180305]
Predicted Effect probably benign
Transcript: ENSMUST00000126666
SMART Domains Protein: ENSMUSP00000121372
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 212 6.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128377
SMART Domains Protein: ENSMUSP00000136152
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 7 166 1.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134348
SMART Domains Protein: ENSMUSP00000119533
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 77 3.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145726
SMART Domains Protein: ENSMUSP00000136665
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 1 100 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148989
SMART Domains Protein: ENSMUSP00000120712
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 3 188 4.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153873
SMART Domains Protein: ENSMUSP00000115396
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 114 9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179937
SMART Domains Protein: ENSMUSP00000136030
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 3 134 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180305
SMART Domains Protein: ENSMUSP00000136682
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
low complexity region 23 59 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GTGGCGGCGGCGGC G 2: 25,272,537 probably null Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,918 probably benign Het
Cckbr CAG C 7: 105,434,687 probably null Het
Defb22 TGGCCT TGGCCTCTGCGGCAGAGCCGGCCT 2: 152,485,825 probably benign Het
Dmkn GGTGGAAGTGGTGGAAGTGGTGGAAGT GGTGGAAGTGGTGGAAGTGGTGGAAGTCGTGGAAGTGGTGGAAGTGGTGGAAGT 7: 30,767,175 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,755 probably benign Het
Efhd2 CC CCGCCGAC 4: 141,874,774 probably benign Het
Fsip2 TTTT TTTTGTTT 2: 82,984,363 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5591 GC G 7: 38,522,335 probably null Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACCACCGCC ACCACCGCCACCGCC 11: 99,389,264 probably benign Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCGGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,028 probably benign Het
Nusap1 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGGAAGCTGAGA 2: 119,627,601 probably benign Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
St5 GGGCAGCCCTCACTGA G 7: 109,556,946 probably benign Het
Tfeb GCA GCATCA 17: 47,786,100 probably benign Het
Zfp384 CCCAGGCCCAGGCCCAGGCCCAGG CCCAGGCCCAGGACCAGGCCCAGGCCCAGGCCCAGG 6: 125,036,466 probably benign Het
Other mutations in Tnfaip8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Tnfaip8 APN 18 50090326 missense probably damaging 1.00
IGL03391:Tnfaip8 APN 18 50090485 missense probably damaging 0.96
FR4304:Tnfaip8 UTSW 18 50046839 frame shift probably null
FR4449:Tnfaip8 UTSW 18 50046839 frame shift probably null
R0605:Tnfaip8 UTSW 18 50046845 small deletion probably benign
R1696:Tnfaip8 UTSW 18 50090223 nonsense probably null
R1804:Tnfaip8 UTSW 18 50090661 missense probably damaging 1.00
R2247:Tnfaip8 UTSW 18 50046845 frame shift probably null
R3963:Tnfaip8 UTSW 18 50090586 missense possibly damaging 0.95
R4258:Tnfaip8 UTSW 18 50090376 missense possibly damaging 0.55
R4738:Tnfaip8 UTSW 18 50090502 missense probably damaging 1.00
R6229:Tnfaip8 UTSW 18 50051675 unclassified probably benign
R7786:Tnfaip8 UTSW 18 50047111 missense unknown
R7786:Tnfaip8 UTSW 18 50047112 missense unknown
RF024:Tnfaip8 UTSW 18 50046831 critical splice donor site probably benign
RF052:Tnfaip8 UTSW 18 50046833 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGTTCTTGTCCAAAATCTGACATG -3'
(R):5'- GTGAAGCGTTCAGAAGCCAG -3'

Sequencing Primer
(F):5'- TGTCCAAAATCTGACATGAAAGAAGC -3'
(R):5'- GGGACCCCCAGTAATCACCTC -3'
Posted On2019-12-04