Incidental Mutation 'R7854:Glce'
ID607135
Institutional Source Beutler Lab
Gene Symbol Glce
Ensembl Gene ENSMUSG00000032252
Gene Nameglucuronyl C5-epimerase
Synonyms1110017N23Rik, C130034A12Rik, Hsepi, heparan sulfate-glucuronic acid C5-epimerase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7854 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location62057248-62122655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62070491 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 37 (I37N)
Ref Sequence ENSEMBL: ENSMUSP00000034785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034785] [ENSMUST00000185675] [ENSMUST00000185873]
Predicted Effect probably benign
Transcript: ENSMUST00000034785
AA Change: I37N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034785
Gene: ENSMUSG00000032252
AA Change: I37N

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185675
AA Change: I37N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139949
Gene: ENSMUSG00000032252
AA Change: I37N

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 6.1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185873
AA Change: I37N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0990 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die immediately after birth showing severe developmental defects including renal agenesis, lung abnormalities, and skeletal malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,112,377 Y48F probably benign Het
Adgrv1 T A 13: 81,593,088 I86F probably damaging Het
Aes A G 10: 81,565,647 H183R probably damaging Het
Als2cl A G 9: 110,898,496 *953W probably null Het
Ap1g2 A G 14: 55,105,933 F66L probably damaging Het
Aqp12 T G 1: 93,006,454 C18G probably damaging Het
Atp9a T C 2: 168,648,603 I826V probably benign Het
C1ra A G 6: 124,517,741 Q321R probably benign Het
Calcoco1 T C 15: 102,719,556 I48V possibly damaging Het
Cep63 A T 9: 102,602,998 S269R probably damaging Het
Chchd7 T C 4: 3,943,422 V63A possibly damaging Het
Dennd5b T C 6: 149,068,466 D163G probably benign Het
Dpep2 T C 8: 105,989,528 D251G Het
Ercc6 T C 14: 32,566,292 L807P probably damaging Het
Fads6 A T 11: 115,297,396 D27E probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gps2 T C 11: 69,915,204 L128P probably damaging Het
Gramd3 A G 18: 56,478,854 T130A probably damaging Het
Hectd4 T A 5: 121,329,568 Y2527N probably benign Het
Itpr1 A G 6: 108,387,369 D820G probably damaging Het
Itsn2 T C 12: 4,701,276 Y1289H probably damaging Het
Kcnh6 A T 11: 106,017,346 I263F probably damaging Het
Kcns2 A T 15: 34,839,771 M427L probably benign Het
Mptx1 A T 1: 174,332,400 M91L probably benign Het
Mtx2 A G 2: 74,868,887 Y128C probably damaging Het
Myh9 A T 15: 77,791,753 D244E probably benign Het
Ndufs2 T C 1: 171,239,369 D140G probably damaging Het
Obscn T C 11: 59,090,712 T1827A probably benign Het
Ogn A T 13: 49,621,038 Y219F possibly damaging Het
Olfr356 A G 2: 36,938,024 R302G probably benign Het
Olfr568 C T 7: 102,877,785 R222* probably null Het
Parp4 A G 14: 56,659,348 E1943G unknown Het
Pex19 T G 1: 172,126,850 probably null Het
Prss53 T C 7: 127,888,945 N166S probably benign Het
Prx T A 7: 27,516,641 V328E probably damaging Het
Pstpip2 C T 18: 77,874,304 T258I probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Ros1 T C 10: 52,128,467 Y1019C probably damaging Het
Rptor T C 11: 119,857,953 M787T probably benign Het
Rsf1 GGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCGGCGGC 7: 97,579,924 probably benign Het
Spef2 T A 15: 9,596,644 R1440W possibly damaging Het
Spta1 T A 1: 174,218,830 probably null Het
Sptbn4 T C 7: 27,362,410 I2335V probably benign Het
Srp68 G C 11: 116,254,083 probably null Het
Taar1 A G 10: 23,920,782 D126G probably benign Het
Tdrd9 A G 12: 112,046,961 T1210A probably benign Het
Tpcn1 A G 5: 120,549,588 F364L probably damaging Het
Trav2 A T 14: 52,567,781 K20* probably null Het
Trpa1 T C 1: 14,881,694 E927G probably benign Het
Tyk2 A T 9: 21,115,480 D637E probably benign Het
Vmn1r200 T C 13: 22,395,839 F271L probably benign Het
Vmn1r231 T A 17: 20,890,632 D7V probably damaging Het
Wwc2 G A 8: 47,868,477 T534I unknown Het
Other mutations in Glce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Glce APN 9 62060483 missense probably damaging 1.00
IGL02005:Glce APN 9 62060577 missense probably damaging 1.00
IGL02093:Glce APN 9 62070539 missense probably damaging 1.00
IGL02102:Glce APN 9 62070601 utr 5 prime probably benign
IGL02243:Glce APN 9 62070140 missense probably damaging 1.00
IGL03099:Glce APN 9 62060062 missense probably benign 0.18
R0004:Glce UTSW 9 62068579 missense probably damaging 1.00
R0626:Glce UTSW 9 62061000 missense probably benign
R1204:Glce UTSW 9 62070567 missense probably damaging 0.99
R1436:Glce UTSW 9 62070010 splice site probably null
R1475:Glce UTSW 9 62060928 missense possibly damaging 0.75
R1622:Glce UTSW 9 62070561 missense possibly damaging 0.90
R1712:Glce UTSW 9 62070575 missense probably damaging 1.00
R1740:Glce UTSW 9 62070533 missense probably damaging 0.97
R2060:Glce UTSW 9 62060946 missense possibly damaging 0.83
R4424:Glce UTSW 9 62060253 missense probably damaging 1.00
R4893:Glce UTSW 9 62068495 missense probably benign
R5350:Glce UTSW 9 62060305 nonsense probably null
R5569:Glce UTSW 9 62070203 missense probably benign 0.35
R5666:Glce UTSW 9 62060511 missense probably damaging 1.00
R5670:Glce UTSW 9 62060511 missense probably damaging 1.00
R5743:Glce UTSW 9 62070540 missense probably damaging 1.00
R5909:Glce UTSW 9 62060144 missense probably damaging 1.00
R7091:Glce UTSW 9 62060588 missense probably damaging 1.00
R7139:Glce UTSW 9 62070434 nonsense probably null
R7549:Glce UTSW 9 62060993 missense probably damaging 1.00
R7965:Glce UTSW 9 62060946 missense probably damaging 1.00
R8022:Glce UTSW 9 62060591 missense probably benign 0.08
R8264:Glce UTSW 9 62060430 missense probably benign
R8743:Glce UTSW 9 62060821 missense probably benign 0.01
X0057:Glce UTSW 9 62060370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGCCCTAACACCTTGC -3'
(R):5'- AAAATATTCTGGCCGCACATTG -3'

Sequencing Primer
(F):5'- GCTTCCCCCGTTGCTATTGAAG -3'
(R):5'- CCTCCATAGGTATGGTCTGA -3'
Posted On2019-12-20