Incidental Mutation 'R7876:Zdhhc23'
ID608461
Institutional Source Beutler Lab
Gene Symbol Zdhhc23
Ensembl Gene ENSMUSG00000036304
Gene Namezinc finger, DHHC domain containing 23
SynonymsLOC332175, LOC385651
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7876 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location43965033-43979791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43969300 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 375 (V375E)
Ref Sequence ENSEMBL: ENSMUSP00000128650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036321] [ENSMUST00000132859] [ENSMUST00000165648] [ENSMUST00000178400] [ENSMUST00000231700] [ENSMUST00000232055]
Predicted Effect probably damaging
Transcript: ENSMUST00000036321
AA Change: V372E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044744
Gene: ENSMUSG00000036304
AA Change: V372E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
transmembrane domain 82 99 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 132 151 N/A INTRINSIC
Pfam:zf-DHHC 175 378 3.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122440
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132859
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165648
AA Change: V375E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128650
Gene: ENSMUSG00000036304
AA Change: V375E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
transmembrane domain 82 99 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 132 151 N/A INTRINSIC
transmembrane domain 161 180 N/A INTRINSIC
Pfam:zf-DHHC 244 378 8.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178400
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231700
AA Change: V375E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000232055
AA Change: V338E

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nrg2 T A 18: 36,197,087 Y25F unknown Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Zdhhc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Zdhhc23 APN 16 43973480 missense probably damaging 1.00
R0179:Zdhhc23 UTSW 16 43973703 missense probably benign 0.06
R0180:Zdhhc23 UTSW 16 43973703 missense probably benign 0.06
R1367:Zdhhc23 UTSW 16 43974150 missense probably benign 0.04
R1557:Zdhhc23 UTSW 16 43971466 missense possibly damaging 0.63
R1997:Zdhhc23 UTSW 16 43978942 missense probably damaging 1.00
R2035:Zdhhc23 UTSW 16 43973508 missense probably damaging 1.00
R2153:Zdhhc23 UTSW 16 43973919 missense probably benign 0.03
R2497:Zdhhc23 UTSW 16 43973915 missense probably damaging 1.00
R3432:Zdhhc23 UTSW 16 43974170 splice site probably benign
R4776:Zdhhc23 UTSW 16 43973589 missense possibly damaging 0.79
R5067:Zdhhc23 UTSW 16 43973771 missense probably benign 0.00
R7086:Zdhhc23 UTSW 16 43971510 missense probably damaging 0.98
R7840:Zdhhc23 UTSW 16 43971544 missense possibly damaging 0.93
R8416:Zdhhc23 UTSW 16 43971564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAAATGAATCCTGCATGG -3'
(R):5'- CGCTTGAGTCCCTACTGACAAG -3'

Sequencing Primer
(F):5'- TGCATGGACACTGACGTG -3'
(R):5'- GAGTCCCTACTGACAAGTACAAAATG -3'
Posted On2019-12-20