Incidental Mutation 'R7876:Usp42'
ID608429
Institutional Source Beutler Lab
Gene Symbol Usp42
Ensembl Gene ENSMUSG00000051306
Gene Nameubiquitin specific peptidase 42
SynonymsA630018G05Rik, D5Ertd591e, 3110031A07Rik, 2410140K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7876 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143710325-143732280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143721671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000053955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053287]
Predicted Effect probably damaging
Transcript: ENSMUST00000053287
AA Change: T252A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306
AA Change: T252A

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
Pfam:UCH 109 408 1.4e-46 PFAM
Pfam:UCH_1 110 391 1.4e-18 PFAM
low complexity region 470 490 N/A INTRINSIC
low complexity region 567 579 N/A INTRINSIC
low complexity region 604 613 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 954 962 N/A INTRINSIC
low complexity region 1016 1031 N/A INTRINSIC
low complexity region 1201 1219 N/A INTRINSIC
low complexity region 1239 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit fecundity and behavioral abnormalities, hyperactivity, increased T cell number, abnormal lens morphology, and cataracts. Males display oligozoospermia and testis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nrg2 T A 18: 36,197,087 Y25F unknown Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Usp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Usp42 APN 5 143717142 missense probably benign 0.00
IGL00902:Usp42 APN 5 143719874 splice site probably benign
IGL01326:Usp42 APN 5 143721215 missense possibly damaging 0.54
IGL01985:Usp42 APN 5 143715185 missense probably damaging 1.00
IGL02629:Usp42 APN 5 143723154 missense possibly damaging 0.94
IGL02683:Usp42 APN 5 143715346 missense possibly damaging 0.55
IGL02700:Usp42 APN 5 143717128 missense probably benign 0.01
IGL02965:Usp42 APN 5 143728014 missense probably damaging 1.00
PIT4468001:Usp42 UTSW 5 143714644 missense probably damaging 1.00
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0420:Usp42 UTSW 5 143714861 missense probably damaging 0.99
R1066:Usp42 UTSW 5 143718041 missense probably damaging 1.00
R1345:Usp42 UTSW 5 143717333 missense probably damaging 1.00
R1628:Usp42 UTSW 5 143717367 missense probably damaging 1.00
R1728:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1729:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1767:Usp42 UTSW 5 143714866 missense possibly damaging 0.69
R1772:Usp42 UTSW 5 143717102 missense probably damaging 1.00
R1784:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1916:Usp42 UTSW 5 143715056 missense probably damaging 1.00
R2425:Usp42 UTSW 5 143715839 missense probably benign 0.09
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2886:Usp42 UTSW 5 143721629 splice site probably benign
R3195:Usp42 UTSW 5 143717199 missense probably benign 0.02
R3737:Usp42 UTSW 5 143715439 missense probably benign 0.00
R3738:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4034:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4795:Usp42 UTSW 5 143723937 missense probably damaging 1.00
R4940:Usp42 UTSW 5 143719762 missense probably damaging 1.00
R4967:Usp42 UTSW 5 143715364 missense possibly damaging 0.71
R5282:Usp42 UTSW 5 143721646 missense probably damaging 1.00
R5773:Usp42 UTSW 5 143713712 missense probably benign 0.03
R5778:Usp42 UTSW 5 143719576 missense probably damaging 1.00
R5933:Usp42 UTSW 5 143715515 missense probably benign 0.00
R6192:Usp42 UTSW 5 143717187 missense possibly damaging 0.73
R6275:Usp42 UTSW 5 143714972 missense probably damaging 1.00
R6496:Usp42 UTSW 5 143715103 missense probably damaging 1.00
R6825:Usp42 UTSW 5 143727807 missense probably damaging 1.00
R6939:Usp42 UTSW 5 143727969 missense probably damaging 1.00
R7099:Usp42 UTSW 5 143726645 missense probably damaging 1.00
R7356:Usp42 UTSW 5 143717087 missense possibly damaging 0.56
R8243:Usp42 UTSW 5 143715094 missense probably benign 0.01
X0022:Usp42 UTSW 5 143716060 frame shift probably null
X0027:Usp42 UTSW 5 143717078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAACTCTGAGAGGCAAGTTTTG -3'
(R):5'- AGGCTCATCGCACTTCTACC -3'

Sequencing Primer
(F):5'- TCTATAATCAGAAAAGCAAAAGCTCC -3'
(R):5'- CTTCTACCCACAGTACAGAGTATC -3'
Posted On2019-12-20