Incidental Mutation 'R8083:Tagln2'
ID629451
Institutional Source Beutler Lab
Gene Symbol Tagln2
Ensembl Gene ENSMUSG00000026547
Gene Nametransgelin 2
SynonymsSm22B, 2700094C18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8083 (G1)
Quality Score222.009
Status Validated
Chromosome1
Chromosomal Location172500047-172507380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172505199 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 18 (I18F)
Ref Sequence ENSEMBL: ENSMUSP00000106861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111228] [ENSMUST00000111230] [ENSMUST00000192460]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111228
AA Change: I18F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106859
Gene: ENSMUSG00000026547
AA Change: I18F

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 198 7e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111230
AA Change: I18F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106861
Gene: ENSMUSG00000026547
AA Change: I18F

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 199 1.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192460
AA Change: I18F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141983
Gene: ENSMUSG00000026547
AA Change: I18F

DomainStartEndE-ValueType
Pfam:CH 27 90 9.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in T cell physiology including cytotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,441,067 E255G possibly damaging Het
Abcg5 A T 17: 84,658,543 L635Q probably damaging Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Adam32 A T 8: 24,872,736 C558S probably damaging Het
Adamtsl4 C T 3: 95,684,401 V126M possibly damaging Het
Apobec1 G A 6: 122,578,929 P190S probably damaging Het
Arel1 A T 12: 84,940,362 H93Q probably benign Het
Bpifa2 T G 2: 154,010,492 V96G probably damaging Het
Cacna1s G A 1: 136,095,791 V923I possibly damaging Het
Caprin2 A C 6: 148,842,848 Y1026* probably null Het
Cdk8 T G 5: 146,268,290 W34G probably damaging Het
Cdkn3 A T 14: 46,762,601 Q28L probably benign Het
Cfap58 A G 19: 47,983,518 E629G probably damaging Het
Chaf1b T A 16: 93,894,742 C255S probably damaging Het
Clcn4 A G 7: 7,291,428 F445L possibly damaging Het
Cpne6 A C 14: 55,513,241 I140L probably benign Het
Cyp2b23 C A 7: 26,686,403 A10S possibly damaging Het
Eci3 G T 13: 34,956,890 T103K probably benign Het
Eri3 T A 4: 117,593,162 M253K probably damaging Het
Gm21103 C T 14: 6,301,907 V169M possibly damaging Het
Gm35060 T C 18: 32,458,754 probably null Het
Gm6594 G A 17: 82,539,468 A71T probably benign Het
Gns T C 10: 121,378,103 S228P probably damaging Het
Hbegf A T 18: 36,515,171 S46T probably benign Het
Hcn1 GCAACAACA GCAACAACAACA 13: 117,975,760 probably benign Het
Mcf2l T A 8: 13,007,875 probably null Het
Nfasc T C 1: 132,596,582 D846G probably benign Het
Nt5dc2 A G 14: 31,134,826 Y103C probably damaging Het
Osbpl9 C T 4: 109,086,375 V147M possibly damaging Het
Pid1 T C 1: 84,038,249 I146V probably benign Het
Rangap1 A G 15: 81,718,900 I108T probably benign Het
Rbm12b1 T C 4: 12,146,409 Y794H probably damaging Het
Rprd1b T C 2: 158,050,132 S192P probably damaging Het
Sacs A T 14: 61,210,717 D3404V possibly damaging Het
Setd5 G T 6: 113,115,010 G264V probably damaging Het
Ttc17 C A 2: 94,374,564 V338F probably damaging Het
Xirp2 T A 2: 67,508,699 M428K possibly damaging Het
Zfp503 A T 14: 21,986,064 D261E probably damaging Het
Zfp784 T C 7: 5,035,906 T218A possibly damaging Het
Zp3 A C 5: 135,984,522 D236A probably damaging Het
Other mutations in Tagln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0468:Tagln2 UTSW 1 172506221 missense probably benign 0.23
R1576:Tagln2 UTSW 1 172505221 missense probably benign 0.02
R5680:Tagln2 UTSW 1 172505912 missense probably damaging 1.00
R6860:Tagln2 UTSW 1 172505909 missense probably benign 0.32
R7149:Tagln2 UTSW 1 172505819 missense probably damaging 0.98
R7554:Tagln2 UTSW 1 172505844 missense probably damaging 1.00
R7977:Tagln2 UTSW 1 172505253 missense probably benign
R7987:Tagln2 UTSW 1 172505253 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGAAATGTAGTATCTGTGTGGC -3'
(R):5'- CTGTGTAAAACGCTCCCTGG -3'

Sequencing Primer
(F):5'- TTCCTACTGGCCAGAGTCCAG -3'
(R):5'- GTAAAACGCTCCCTGGTCCCC -3'
Posted On2020-06-30