Incidental Mutation 'R7149:Tagln2'
ID553985
Institutional Source Beutler Lab
Gene Symbol Tagln2
Ensembl Gene ENSMUSG00000026547
Gene Nametransgelin 2
SynonymsSm22B, 2700094C18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172500047-172507380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172505819 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 80 (I80N)
Ref Sequence ENSEMBL: ENSMUSP00000106861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111228] [ENSMUST00000111230] [ENSMUST00000192460]
Predicted Effect probably damaging
Transcript: ENSMUST00000111228
AA Change: I80N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106859
Gene: ENSMUSG00000026547
AA Change: I80N

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 198 7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111230
AA Change: I80N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106861
Gene: ENSMUSG00000026547
AA Change: I80N

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 199 1.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192460
AA Change: I80N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141983
Gene: ENSMUSG00000026547
AA Change: I80N

DomainStartEndE-ValueType
Pfam:CH 27 90 9.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in T cell physiology including cytotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Tagln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0468:Tagln2 UTSW 1 172506221 missense probably benign 0.23
R1576:Tagln2 UTSW 1 172505221 missense probably benign 0.02
R5680:Tagln2 UTSW 1 172505912 missense probably damaging 1.00
R6860:Tagln2 UTSW 1 172505909 missense probably benign 0.32
R7554:Tagln2 UTSW 1 172505844 missense probably damaging 1.00
R7977:Tagln2 UTSW 1 172505253 missense probably benign
R7987:Tagln2 UTSW 1 172505253 missense probably benign
R8083:Tagln2 UTSW 1 172505199 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGGGTTCAAAGGCAGGAG -3'
(R):5'- GCAGTATGGCCCATCCTTGATC -3'

Sequencing Primer
(F):5'- AGGCACCTTGAGGCTCAC -3'
(R):5'- CTTTGGTAAAGTTGGCCCAGTCC -3'
Posted On2019-05-15