Incidental Mutation 'R8300:Paics'
ID639195
Institutional Source Beutler Lab
Gene Symbol Paics
Ensembl Gene ENSMUSG00000029247
Gene Namephosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase
SynonymsADE2H1, 2610511I09Rik, PAIS, AIRC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8300 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76951307-76967509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76961406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000031160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031160] [ENSMUST00000117536] [ENSMUST00000120912] [ENSMUST00000141687] [ENSMUST00000153648]
Predicted Effect probably damaging
Transcript: ENSMUST00000031160
AA Change: V196A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031160
Gene: ENSMUSG00000029247
AA Change: V196A

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 253 4.8e-81 PFAM
AIRC 266 413 8.36e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117536
AA Change: V196A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112879
Gene: ENSMUSG00000029247
AA Change: V196A

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 253 4.8e-81 PFAM
AIRC 266 413 8.36e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120912
AA Change: V196A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113483
Gene: ENSMUSG00000029247
AA Change: V196A

DomainStartEndE-ValueType
Pfam:SAICAR_synt 11 248 4e-56 PFAM
AIRC 266 413 8.36e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141687
SMART Domains Protein: ENSMUSP00000117027
Gene: ENSMUSG00000029247

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 83 9.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153648
SMART Domains Protein: ENSMUSP00000123558
Gene: ENSMUSG00000029247

DomainStartEndE-ValueType
Pfam:SAICAR_synt 9 94 9.6e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional enzyme containing phosphoribosylaminoimidazole carboxylase activity in its N-terminal region and phosphoribosylaminoimidazole succinocarboxamide synthetase in its C-terminal region. It catalyzes steps 6 and 7 of purine biosynthesis. The gene is closely linked and divergently transcribed with a locus that encodes an enzyme in the same pathway, and transcription of the two genes is coordinately regulated. The human genome contains several pseudogenes of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,423 Y109* probably null Het
1700024P16Rik A T 4: 105,000,492 K622M probably damaging Het
6430531B16Rik A T 7: 139,977,178 I98N probably damaging Het
AB124611 A G 9: 21,526,265 M1V probably null Het
Abca12 T A 1: 71,313,964 N773I possibly damaging Het
Adh7 A G 3: 138,224,064 E167G probably damaging Het
Ank2 T A 3: 127,010,906 D622V Het
Asf1b T A 8: 83,969,176 F149I possibly damaging Het
Bach1 T C 16: 87,719,108 V179A probably benign Het
C1ra C T 6: 124,521,638 A430V probably benign Het
Cacna1c T A 6: 118,598,756 Q1944L Het
Camkk1 T C 11: 73,027,440 V158A probably benign Het
Ccdc152 T C 15: 3,298,152 T48A probably benign Het
Cd180 A T 13: 102,704,793 M116L probably benign Het
Clca2 C T 3: 145,098,931 G12R probably benign Het
Coq8b T C 7: 27,242,246 V252A possibly damaging Het
Cp A G 3: 19,957,221 probably benign Het
Ctsj A T 13: 61,002,471 V238E probably damaging Het
Ctsj C T 13: 61,002,472 V238I probably damaging Het
Cxcr2 A T 1: 74,159,174 M276L probably benign Het
Drd5 T C 5: 38,320,329 S222P probably damaging Het
Egflam T C 15: 7,254,451 D269G possibly damaging Het
Fbn2 C T 18: 58,209,615 R64Q probably benign Het
Gm10220 T C 5: 26,117,820 E198G probably damaging Het
Gm1527 A T 3: 28,926,595 N615Y possibly damaging Het
Gpatch3 A G 4: 133,579,829 H308R probably damaging Het
Gsdmc4 A G 15: 63,894,941 I261T probably damaging Het
Gsg1 T G 6: 135,237,582 T310P probably benign Het
Hecw2 T C 1: 53,887,616 S1075G probably null Het
Hyal6 A G 6: 24,734,088 T7A probably benign Het
Ighv1-59 T G 12: 115,335,367 Q22H probably damaging Het
Lyst T A 13: 13,664,058 M1853K possibly damaging Het
Mccc1 A T 3: 35,963,604 M649K probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nek4 A G 14: 30,970,395 D399G Het
Obscn T C 11: 59,043,070 K5323E probably benign Het
Olfr414 T A 1: 174,430,534 Y35* probably null Het
Pced1a C A 2: 130,424,237 probably benign Het
Pik3cb A G 9: 99,046,658 V848A probably damaging Het
Ppm1h T A 10: 122,782,213 N92K probably damaging Het
Ppp1r16b T A 2: 158,746,651 I152N probably damaging Het
Pramel7 A G 2: 87,489,623 M442T probably benign Het
Prex2 A T 1: 11,231,718 N1415I possibly damaging Het
Pum3 T C 19: 27,422,373 K220R probably benign Het
Qrich2 G T 11: 116,456,349 D1216E probably benign Het
Rbbp8 T A 18: 11,705,776 silent Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp2 C T 5: 128,797,771 R252Q probably damaging Het
Rnpep T C 1: 135,283,659 H117R probably benign Het
Serpinb10 A G 1: 107,546,726 D206G probably benign Het
Sh3tc1 C T 5: 35,697,448 V1302M probably benign Het
Slmap T C 14: 26,418,219 E780G possibly damaging Het
Snrpg T A 6: 86,376,576 V46E probably damaging Het
Sptbn5 T A 2: 120,047,577 Q953L noncoding transcript Het
Stard9 C T 2: 120,704,769 L3836F possibly damaging Het
Tcerg1 T A 18: 42,550,072 M619K probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem57 A G 4: 134,828,451 I237T probably benign Het
Tnfrsf9 C T 4: 150,933,099 T137M probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trak1 G T 9: 121,460,499 E626* probably null Het
Trio G T 15: 27,855,022 H750Q possibly damaging Het
U2af2 T C 7: 5,067,415 probably benign Het
Vmn2r3 T C 3: 64,274,926 I451V probably benign Het
Zfp930 A T 8: 69,228,346 N230I probably benign Het
Other mutations in Paics
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Paics APN 5 76956731 missense probably damaging 1.00
IGL01642:Paics APN 5 76961510 splice site probably benign
IGL01689:Paics APN 5 76961291 critical splice donor site probably null
IGL02559:Paics APN 5 76964604 missense possibly damaging 0.55
IGL02814:Paics APN 5 76962473 missense probably damaging 0.99
IGL03093:Paics APN 5 76961508 critical splice donor site probably null
IGL02980:Paics UTSW 5 76966255 missense probably benign 0.00
LCD18:Paics UTSW 5 76956744 frame shift probably null
R2179:Paics UTSW 5 76961444 missense probably damaging 1.00
R4573:Paics UTSW 5 76956603 missense probably benign 0.09
R4926:Paics UTSW 5 76961204 missense probably damaging 1.00
R5134:Paics UTSW 5 76956822 intron probably benign
R5308:Paics UTSW 5 76956632 missense probably damaging 1.00
R7996:Paics UTSW 5 76959429 missense probably benign 0.11
R8506:Paics UTSW 5 76964590 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTCTGGAGAAATCCTGGCTG -3'
(R):5'- GCCATTGGGTTGTATCTCCAG -3'

Sequencing Primer
(F):5'- TGCCCCAGGACTGTACG -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2020-07-28