Incidental Mutation 'R8300:1700007K13Rik'
ID639175
Institutional Source Beutler Lab
Gene Symbol 1700007K13Rik
Ensembl Gene ENSMUSG00000026831
Gene NameRIKEN cDNA 1700007K13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8300 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28462001-28466332 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28462423 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 109 (Y109*)
Ref Sequence ENSEMBL: ENSMUSP00000083557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably null
Transcript: ENSMUST00000086370
AA Change: Y109*
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831
AA Change: Y109*

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127683
AA Change: I108N

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831
AA Change: I108N

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe laterality defects, including situs inversus totalis and heterotaxy with randomized situs and left and right isomerisms. Homozygous embryos with isomerisms die in utero due to associated cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P16Rik A T 4: 105,000,492 K622M probably damaging Het
6430531B16Rik A T 7: 139,977,178 I98N probably damaging Het
AB124611 A G 9: 21,526,265 M1V probably null Het
Abca12 T A 1: 71,313,964 N773I possibly damaging Het
Adh7 A G 3: 138,224,064 E167G probably damaging Het
Ank2 T A 3: 127,010,906 D622V Het
Asf1b T A 8: 83,969,176 F149I possibly damaging Het
Bach1 T C 16: 87,719,108 V179A probably benign Het
C1ra C T 6: 124,521,638 A430V probably benign Het
Cacna1c T A 6: 118,598,756 Q1944L Het
Camkk1 T C 11: 73,027,440 V158A probably benign Het
Ccdc152 T C 15: 3,298,152 T48A probably benign Het
Cd180 A T 13: 102,704,793 M116L probably benign Het
Clca2 C T 3: 145,098,931 G12R probably benign Het
Coq8b T C 7: 27,242,246 V252A possibly damaging Het
Cp A G 3: 19,957,221 probably benign Het
Ctsj A T 13: 61,002,471 V238E probably damaging Het
Ctsj C T 13: 61,002,472 V238I probably damaging Het
Cxcr2 A T 1: 74,159,174 M276L probably benign Het
Drd5 T C 5: 38,320,329 S222P probably damaging Het
Egflam T C 15: 7,254,451 D269G possibly damaging Het
Fbn2 C T 18: 58,209,615 R64Q probably benign Het
Gm10220 T C 5: 26,117,820 E198G probably damaging Het
Gm1527 A T 3: 28,926,595 N615Y possibly damaging Het
Gpatch3 A G 4: 133,579,829 H308R probably damaging Het
Gsdmc4 A G 15: 63,894,941 I261T probably damaging Het
Gsg1 T G 6: 135,237,582 T310P probably benign Het
Hecw2 T C 1: 53,887,616 S1075G probably null Het
Hyal6 A G 6: 24,734,088 T7A probably benign Het
Ighv1-59 T G 12: 115,335,367 Q22H probably damaging Het
Lyst T A 13: 13,664,058 M1853K possibly damaging Het
Mccc1 A T 3: 35,963,604 M649K probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nek4 A G 14: 30,970,395 D399G Het
Obscn T C 11: 59,043,070 K5323E probably benign Het
Olfr414 T A 1: 174,430,534 Y35* probably null Het
Paics T C 5: 76,961,406 V196A probably damaging Het
Pced1a C A 2: 130,424,237 probably benign Het
Pik3cb A G 9: 99,046,658 V848A probably damaging Het
Ppm1h T A 10: 122,782,213 N92K probably damaging Het
Ppp1r16b T A 2: 158,746,651 I152N probably damaging Het
Pramel7 A G 2: 87,489,623 M442T probably benign Het
Prex2 A T 1: 11,231,718 N1415I possibly damaging Het
Pum3 T C 19: 27,422,373 K220R probably benign Het
Qrich2 G T 11: 116,456,349 D1216E probably benign Het
Rbbp8 T A 18: 11,705,776 silent Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rimbp2 C T 5: 128,797,771 R252Q probably damaging Het
Rnpep T C 1: 135,283,659 H117R probably benign Het
Serpinb10 A G 1: 107,546,726 D206G probably benign Het
Sh3tc1 C T 5: 35,697,448 V1302M probably benign Het
Slmap T C 14: 26,418,219 E780G possibly damaging Het
Snrpg T A 6: 86,376,576 V46E probably damaging Het
Sptbn5 T A 2: 120,047,577 Q953L noncoding transcript Het
Stard9 C T 2: 120,704,769 L3836F possibly damaging Het
Tcerg1 T A 18: 42,550,072 M619K probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tmem57 A G 4: 134,828,451 I237T probably benign Het
Tnfrsf9 C T 4: 150,933,099 T137M probably damaging Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trak1 G T 9: 121,460,499 E626* probably null Het
Trio G T 15: 27,855,022 H750Q possibly damaging Het
U2af2 T C 7: 5,067,415 probably benign Het
Vmn2r3 T C 3: 64,274,926 I451V probably benign Het
Zfp930 A T 8: 69,228,346 N230I probably benign Het
Other mutations in 1700007K13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:1700007K13Rik APN 2 28465180 missense probably damaging 0.97
R0423:1700007K13Rik UTSW 2 28466024 splice site probably benign
R0604:1700007K13Rik UTSW 2 28466091 missense possibly damaging 0.55
R6580:1700007K13Rik UTSW 2 28466050 missense probably damaging 1.00
R6819:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7292:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7351:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7441:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7569:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7620:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7802:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7898:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7959:1700007K13Rik UTSW 2 28462357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGATCAAGGGCATCCG -3'
(R):5'- ACACTGGCATGGTTGGATG -3'

Sequencing Primer
(F):5'- TCCCTTAGTCACAGATGGACG -3'
(R):5'- GCATGGTTGGATGGCAAAG -3'
Posted On2020-07-28