Incidental Mutation 'R8229:Smc6'
ID640955
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8229 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11291672 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 564 (S564T)
Ref Sequence ENSEMBL: ENSMUSP00000020931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931]
Predicted Effect probably benign
Transcript: ENSMUST00000020931
AA Change: S564T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608
AA Change: S564T

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 24,711,738 M203K probably damaging Het
Arhgap23 G A 11: 97,453,906 V565I probably benign Het
D6Wsu163e G T 6: 126,967,003 R454L probably benign Het
Def6 A G 17: 28,217,755 D131G probably damaging Het
Erc1 T C 6: 119,753,288 T616A probably benign Het
Ermard T A 17: 15,059,334 probably benign Het
Fsip2 T C 2: 82,978,143 L1602P possibly damaging Het
Gli1 C T 10: 127,332,448 R512Q possibly damaging Het
Gm6034 A G 17: 36,056,376 T38A unknown Het
H2-M10.1 T C 17: 36,324,039 I325V probably benign Het
Inf2 A G 12: 112,611,596 D1107G unknown Het
Iws1 A G 18: 32,084,687 N448S probably benign Het
Klhl24 T C 16: 20,114,571 Y311H possibly damaging Het
Lama3 C T 18: 12,407,551 A304V probably benign Het
Limch1 A G 5: 67,028,795 E646G probably damaging Het
Lrrc8c T A 5: 105,606,536 V59E probably benign Het
Lrrn4 G A 2: 132,869,887 T672I probably damaging Het
Magi3 C A 3: 104,015,701 E1233D possibly damaging Het
Magi3 T C 3: 104,015,702 E1233G probably benign Het
Mgat5b A T 11: 116,947,387 K284M probably benign Het
Nedd4 G T 9: 72,731,388 K485N probably benign Het
Olfr1141 A T 2: 87,753,064 C310S probably benign Het
Olfr1219 T A 2: 89,075,038 N18Y possibly damaging Het
Olfr1453 A G 19: 13,028,197 I44T possibly damaging Het
Olfr480 C T 7: 108,066,587 M70I probably benign Het
Otud4 A G 8: 79,673,975 H1106R unknown Het
Pcdha7 C A 18: 36,974,723 S267* probably null Het
Pcdhb11 A G 18: 37,422,618 I334V probably benign Het
Phf11b A T 14: 59,331,281 L61Q probably damaging Het
Prepl T C 17: 85,081,261 D138G probably benign Het
Sipa1l1 T C 12: 82,437,848 V1592A probably damaging Het
Spty2d1 A G 7: 46,997,774 V469A probably benign Het
Trim11 G A 11: 58,981,341 probably benign Het
Ttll7 T A 3: 146,901,449 I158K probably damaging Het
Ugt3a2 A G 15: 9,367,377 E402G probably damaging Het
Usp33 T C 3: 152,370,292 V383A probably benign Het
Ythdc1 A G 5: 86,809,308 probably benign Het
Ywhab T G 2: 164,014,095 Y130* probably null Het
Zfp609 T C 9: 65,703,500 K727R possibly damaging Het
Zscan30 A C 18: 23,971,680 L37R noncoding transcript Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 splice site probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 splice site probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11309300 missense probably damaging 1.00
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
R7477:Smc6 UTSW 12 11271807 missense probably benign
R7698:Smc6 UTSW 12 11283140 missense possibly damaging 0.92
R7832:Smc6 UTSW 12 11317843 missense probably benign 0.28
R7863:Smc6 UTSW 12 11289129 missense probably benign 0.00
R8192:Smc6 UTSW 12 11299335 missense probably benign 0.01
R8289:Smc6 UTSW 12 11274051 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CAAGTTCTTCTAGGGAGTGATCTC -3'
(R):5'- AAGAGTTTTGGCTATCATCCCC -3'

Sequencing Primer
(F):5'- GTGATCTCTCTGTAGGACGATATTAC -3'
(R):5'- TCCCCTTTAGAAGAAAACAGTTCTGC -3'
Posted On2020-07-28