Incidental Mutation 'R8382:Gm906'
ID646989
Institutional Source Beutler Lab
Gene Symbol Gm906
Ensembl Gene ENSMUSG00000095300
Gene Namepredicted gene 906
SynonymsLOC380882
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8382 (G1)
Quality Score148.008
Status Not validated
Chromosome13
Chromosomal Location50245181-50250308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50247438 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 284 (K284R)
Ref Sequence ENSEMBL: ENSMUSP00000097121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099521]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099521
AA Change: K284R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097121
Gene: ENSMUSG00000095300
AA Change: K284R

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
Pfam:FAM75 96 414 5.3e-15 PFAM
SCOP:d1i5pa1 811 874 1e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency 94% (33/35)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,560,682 R689G probably benign Het
Anapc4 T A 5: 52,858,935 probably null Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
C130026I21Rik G A 1: 85,246,950 S288L possibly damaging Het
Cacna1i G A 15: 80,376,816 V1342M probably damaging Het
Ccdc87 A G 19: 4,839,990 D170G possibly damaging Het
Cpsf1 A G 15: 76,600,951 V541A probably benign Het
Depdc5 C T 5: 32,927,898 T687M probably benign Het
Ear6 T C 14: 51,854,113 I39T probably damaging Het
Fam155a T C 8: 9,207,972 E392G probably benign Het
Fcgbp C T 7: 28,117,337 A2408V probably benign Het
Frmd4b G A 6: 97,305,248 T539I probably benign Het
Gif A T 19: 11,749,726 T100S probably benign Het
Gm19410 T A 8: 35,809,148 V1653D probably damaging Het
Jade1 A G 3: 41,564,934 probably null Het
Kncn A G 4: 115,886,750 N75S probably benign Het
Lig4 C T 8: 9,972,346 G478D probably damaging Het
Med24 G A 11: 98,717,711 T205I unknown Het
Meiob A G 17: 24,827,939 E179G possibly damaging Het
Olfr1197 A T 2: 88,729,513 F29I probably damaging Het
Olfr907 A T 9: 38,499,292 I208F probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Pcdh15 T C 10: 74,643,395 V708A probably benign Het
Pclo T A 5: 14,677,066 D1979E unknown Het
Plxnd1 A T 6: 115,972,472 H784Q probably benign Het
Prim1 A T 10: 128,020,269 probably null Het
Rnf17 TG T 14: 56,424,542 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Slc7a5 A T 8: 121,885,952 I371N probably damaging Het
Taf1c G T 8: 119,603,050 D117E probably damaging Het
Tekt5 T C 16: 10,395,064 D119G probably benign Het
Top3b T C 16: 16,888,003 I508T probably damaging Het
Uba6 A G 5: 86,131,337 I673T probably benign Het
Vmn2r17 G T 5: 109,428,521 M419I probably benign Het
Zfr C T 15: 12,152,968 Q562* probably null Het
Zfyve16 A T 13: 92,513,820 D885E probably benign Het
Other mutations in Gm906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00575:Gm906 APN 13 50246716 missense probably damaging 1.00
IGL02008:Gm906 APN 13 50246685 missense probably benign 0.00
R0464:Gm906 UTSW 13 50248275 splice site probably benign
R0481:Gm906 UTSW 13 50246964 missense probably benign 0.33
R0781:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1110:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1945:Gm906 UTSW 13 50245491 missense probably damaging 1.00
R3119:Gm906 UTSW 13 50246969 nonsense probably null
R3824:Gm906 UTSW 13 50245512 missense possibly damaging 0.73
R3861:Gm906 UTSW 13 50246851 missense probably benign 0.00
R4256:Gm906 UTSW 13 50250105 missense probably benign 0.18
R4607:Gm906 UTSW 13 50245506 missense possibly damaging 0.86
R6126:Gm906 UTSW 13 50246290 missense probably benign 0.18
R6550:Gm906 UTSW 13 50245446 missense probably benign 0.00
R6913:Gm906 UTSW 13 50245257 missense probably damaging 0.99
R6970:Gm906 UTSW 13 50246971 missense possibly damaging 0.86
R7339:Gm906 UTSW 13 50247168 missense possibly damaging 0.86
R7347:Gm906 UTSW 13 50245744 missense probably benign 0.01
R7607:Gm906 UTSW 13 50250260 missense possibly damaging 0.72
R7655:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7656:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7711:Gm906 UTSW 13 50247095 missense probably benign 0.43
R7803:Gm906 UTSW 13 50246190 missense probably benign 0.33
R8510:Gm906 UTSW 13 50250192 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAAGGTCCTTCTTGATGGTG -3'
(R):5'- AAGCCTGCCTGGGAAACATG -3'

Sequencing Primer
(F):5'- TGTAGGCACAGACCCCTTC -3'
(R):5'- GCCTGGGAAACATGGACCATATTC -3'
Posted On2020-09-02