Incidental Mutation 'R7945:Cdc42ep1'
ID 649314
Institutional Source Beutler Lab
Gene Symbol Cdc42ep1
Ensembl Gene ENSMUSG00000049521
Gene Name CDC42 effector protein (Rho GTPase binding) 1
Synonyms MSE55, 1810058K22Rik, Borg5, CEP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7945 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78842624-78850897 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78847773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 139 (S139R)
Ref Sequence ENSEMBL: ENSMUSP00000060930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044584] [ENSMUST00000059619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044584
SMART Domains Protein: ENSMUSP00000036598
Gene: ENSMUSG00000043501

DomainStartEndE-ValueType
GLECT 5 130 1.56e-47 SMART
Gal-bind_lectin 8 129 1.44e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059619
AA Change: S139R

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060930
Gene: ENSMUSG00000049521
AA Change: S139R

DomainStartEndE-ValueType
PBD 38 72 2.55e-6 SMART
low complexity region 89 98 N/A INTRINSIC
Pfam:BORG_CEP 115 232 2.5e-21 PFAM
low complexity region 234 266 N/A INTRINSIC
low complexity region 272 291 N/A INTRINSIC
low complexity region 330 347 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,773,213 T346S probably benign Het
4932438A13Rik G A 3: 36,965,893 V2093I probably benign Het
Adprhl1 T A 8: 13,221,929 R1610W probably damaging Het
Afg3l1 C A 8: 123,489,922 A300E probably benign Het
Ano6 A G 15: 95,941,309 Y423C probably damaging Het
BC005561 G T 5: 104,518,547 V312F possibly damaging Het
Casp8ap2 A G 4: 32,645,909 T1661A probably benign Het
Cep57 A G 9: 13,818,931 Y104H probably damaging Het
Chrna4 T C 2: 181,028,661 D434G probably benign Het
Clec1a T C 6: 129,432,187 S159G probably benign Het
Cltc A T 11: 86,737,141 N60K probably benign Het
Cpq T A 15: 33,594,236 D464E probably benign Het
Ctcfl A C 2: 173,118,658 V44G probably benign Het
Dcstamp T A 15: 39,760,401 *471R probably null Het
Disp2 G A 2: 118,792,789 R1334H probably damaging Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Ephb3 A G 16: 21,221,684 T811A probably damaging Het
Fam208b A T 13: 3,576,085 S1288R probably benign Het
Fbxo21 T C 5: 118,008,147 Y612H possibly damaging Het
Gm4969 T A 7: 19,100,086 K508N unknown Het
Gm8005 T A 14: 42,438,373 D102V Het
Golgb1 T C 16: 36,914,104 S1279P probably benign Het
Hdgfl3 T C 7: 81,933,958 Y22C possibly damaging Het
Hpse2 T C 19: 43,384,809 N127S probably benign Het
Hrnr G T 3: 93,332,199 G3248V unknown Het
Krtap27-1 T C 16: 88,671,452 N68S probably benign Het
Lipo3 T C 19: 33,556,431 M334V probably benign Het
Lrrc34 A G 3: 30,642,737 probably null Het
Ltbp1 T G 17: 75,390,551 *1713G probably null Het
Lypd6b A G 2: 49,943,600 E84G probably damaging Het
Mitd1 T C 1: 37,885,265 Y68C probably damaging Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Mroh4 C T 15: 74,624,705 E278K probably damaging Het
Mtmr4 T C 11: 87,604,428 V437A probably damaging Het
Neb T C 2: 52,271,348 D2144G probably damaging Het
Obscn T A 11: 59,093,409 E1740V probably damaging Het
Olfr1104 A G 2: 87,022,313 V77A probably benign Het
Olfr1344 A G 7: 6,440,355 T152A probably benign Het
Pcsk1 G A 13: 75,132,092 A679T probably benign Het
Pdap1 G A 5: 145,131,439 A138V probably damaging Het
Pdzph1 T C 17: 58,932,460 T958A probably damaging Het
Plekha5 T A 6: 140,580,475 H946Q possibly damaging Het
Ppat C A 5: 76,915,391 V458L probably benign Het
Rock1 A G 18: 10,116,831 L435P probably damaging Het
Rtn2 T A 7: 19,287,062 S153R probably benign Het
Serpinb1c A T 13: 32,886,209 H123Q probably benign Het
Slc1a5 C A 7: 16,789,882 R271S possibly damaging Het
Slc23a3 A G 1: 75,129,396 probably null Het
Slc7a6 C T 8: 106,179,607 P157L possibly damaging Het
Syne2 A T 12: 75,904,305 E410V probably damaging Het
Treh T C 9: 44,681,287 V63A probably damaging Het
Trim50 T A 5: 135,353,302 W3R probably benign Het
Ttc6 T G 12: 57,660,443 L712R possibly damaging Het
Ttn G T 2: 76,884,965 Q7928K unknown Het
Ugt3a1 T C 15: 9,284,175 probably null Het
Wapl T C 14: 34,677,148 I58T probably benign Het
Zgrf1 A G 3: 127,562,760 E545G probably benign Het
Zmat4 T A 8: 23,748,420 I6N possibly damaging Het
Zp3r G T 1: 130,596,823 P226Q probably damaging Het
Other mutations in Cdc42ep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Cdc42ep1 UTSW 15 78849680 missense possibly damaging 0.83
R2111:Cdc42ep1 UTSW 15 78847492 missense probably damaging 1.00
R3689:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R3690:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R4456:Cdc42ep1 UTSW 15 78849891 missense possibly damaging 0.72
R5714:Cdc42ep1 UTSW 15 78849777 missense possibly damaging 0.93
R6374:Cdc42ep1 UTSW 15 78847449 missense probably damaging 1.00
R7944:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7995:Cdc42ep1 UTSW 15 78847496 missense probably damaging 1.00
R8010:Cdc42ep1 UTSW 15 78847799 missense possibly damaging 0.62
R9293:Cdc42ep1 UTSW 15 78849825 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATACGTCCTTCCTCAGCAAC -3'
(R):5'- TCTGTGTTATAAGGCCTAAGCAGG -3'

Sequencing Primer
(F):5'- AGGCCGCTCTGGAAACAC -3'
(R):5'- GGATACCCCACCTCCCTAAG -3'
Posted On 2020-09-15