Incidental Mutation 'R8852:Tars'
ID 675077
Institutional Source Beutler Lab
Gene Symbol Tars
Ensembl Gene ENSMUSG00000022241
Gene Name threonyl-tRNA synthetase
Synonyms D15Wsu59e, ThrRS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R8852 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11382301-11399665 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11393262 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 115 (N115K)
Ref Sequence ENSEMBL: ENSMUSP00000022849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]
AlphaFold Q9D0R2
Predicted Effect probably benign
Transcript: ENSMUST00000022849
AA Change: N115K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: N115K

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Pfam:TGS 82 142 7.5e-18 PFAM
tRNA_SAD 248 297 1.91e-16 SMART
Pfam:tRNA-synt_2b 396 607 5e-38 PFAM
Pfam:HGTP_anticodon 619 710 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228814
AA Change: T114K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T G 12: 71,184,423 V985G possibly damaging Het
Acr T G 15: 89,573,854 M246R probably damaging Het
Adgrf5 G T 17: 43,453,098 V1304L possibly damaging Het
Ago4 A T 4: 126,493,250 D853E probably benign Het
Arvcf C A 16: 18,403,453 D790E probably benign Het
Atp8a2 A C 14: 59,925,096 D725E probably damaging Het
C2cd5 A G 6: 143,083,220 Y98H probably benign Het
Camkk2 T C 5: 122,753,757 Y234C probably damaging Het
Ccdc106 A G 7: 5,059,571 D192G probably benign Het
Ccm2l T C 2: 153,074,868 Y340H probably damaging Het
Chd1l A G 3: 97,570,369 F690S probably benign Het
Chuk A G 19: 44,087,968 S435P possibly damaging Het
Cisd3 T A 11: 97,685,877 S10T probably benign Het
Cnppd1 A G 1: 75,136,419 S402P probably damaging Het
Cped1 A G 6: 22,215,621 D718G probably damaging Het
Crtc1 A G 8: 70,388,155 S474P probably damaging Het
Dcpp3 G T 17: 23,919,149 E94* probably null Het
Dhx38 A T 8: 109,562,729 L13* probably null Het
Dmbt1 T C 7: 131,041,123 Y120H unknown Het
Fntb T A 12: 76,888,052 V201E possibly damaging Het
Gga3 T C 11: 115,590,418 D242G probably benign Het
Gsx2 T C 5: 75,076,335 M192T possibly damaging Het
Hif3a A T 7: 17,040,987 M562K probably benign Het
Irf5 G A 6: 29,535,998 R337H probably damaging Het
Kcnmb3 A G 3: 32,472,475 V189A possibly damaging Het
Letmd1 A G 15: 100,475,366 T241A probably benign Het
Lrrc14b T A 13: 74,361,289 D333V probably damaging Het
Meaf6 T A 4: 125,086,197 L48Q probably damaging Het
Miip T A 4: 147,866,382 probably benign Het
Muc4 A G 16: 32,750,643 T236A possibly damaging Het
Myh4 T A 11: 67,241,509 I155N probably damaging Het
Obscn C T 11: 59,007,614 R6607Q unknown Het
Olfr110 G A 17: 37,499,430 V260M probably benign Het
Olfr320 C T 11: 58,684,140 T89I probably benign Het
Otof T C 5: 30,371,700 N1788S possibly damaging Het
Psapl1 T C 5: 36,204,970 L302S probably damaging Het
Rdh8 A C 9: 20,822,725 N69T probably benign Het
Ryr3 T C 2: 112,794,499 E2212G probably damaging Het
Sept7 A T 9: 25,252,684 N16Y possibly damaging Het
Slc22a17 A T 14: 54,908,979 L60Q probably damaging Het
Snrnp200 T C 2: 127,218,429 I531T probably damaging Het
Ssh3 A T 19: 4,267,964 V41E probably damaging Het
Tomm6 G C 17: 47,687,925 F34L possibly damaging Het
Txnrd2 G A 16: 18,440,851 V173M possibly damaging Het
Uba6 T A 5: 86,141,595 I450F possibly damaging Het
Vmn2r95 G T 17: 18,443,851 S516I possibly damaging Het
Vps4b A G 1: 106,782,684 F156L possibly damaging Het
Zfp354c T A 11: 50,815,192 H352L probably damaging Het
Zfp521 T C 18: 13,939,093 D30G probably benign Het
Zic2 A T 14: 122,476,118 H148L possibly damaging Het
Other mutations in Tars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Tars APN 15 11388221 splice site probably null
IGL00642:Tars APN 15 11394372 missense probably damaging 1.00
IGL01315:Tars APN 15 11389734 nonsense probably null
IGL01459:Tars APN 15 11391854 missense possibly damaging 0.76
IGL02141:Tars APN 15 11391194 missense probably damaging 0.96
IGL03292:Tars APN 15 11384021 missense probably benign 0.22
R0383:Tars UTSW 15 11390325 missense probably benign
R0517:Tars UTSW 15 11394366 nonsense probably null
R0685:Tars UTSW 15 11385173 missense probably benign
R1589:Tars UTSW 15 11388175 missense probably benign 0.32
R1753:Tars UTSW 15 11394243 nonsense probably null
R2051:Tars UTSW 15 11393194 nonsense probably null
R2060:Tars UTSW 15 11394373 missense probably benign 0.03
R2216:Tars UTSW 15 11389708 missense probably benign 0.00
R3610:Tars UTSW 15 11392904 missense probably damaging 0.99
R4656:Tars UTSW 15 11394264 missense probably damaging 1.00
R4844:Tars UTSW 15 11385195 missense possibly damaging 0.85
R4974:Tars UTSW 15 11390391 missense probably damaging 1.00
R5551:Tars UTSW 15 11391982 missense probably damaging 0.97
R5992:Tars UTSW 15 11397196 missense probably damaging 1.00
R6742:Tars UTSW 15 11394341 missense probably damaging 0.98
R6778:Tars UTSW 15 11389699 missense probably benign 0.06
R6850:Tars UTSW 15 11392799 missense probably benign
R7270:Tars UTSW 15 11392019 missense probably benign 0.00
R7401:Tars UTSW 15 11392009 nonsense probably null
R7743:Tars UTSW 15 11399372 splice site probably null
R8062:Tars UTSW 15 11388314 missense possibly damaging 0.78
R8942:Tars UTSW 15 11384097 missense probably benign 0.27
R9205:Tars UTSW 15 11397179 critical splice donor site probably null
R9362:Tars UTSW 15 11387530 missense probably damaging 1.00
R9668:Tars UTSW 15 11394360 nonsense probably null
Z1088:Tars UTSW 15 11391884 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TAAACAACTGTGGCCTCCGG -3'
(R):5'- GTGTGCGTTTTAATACCTCCATCAC -3'

Sequencing Primer
(F):5'- TCCGGGTGACACCACAC -3'
(R):5'- TCTCAGTCCTAACAGCAG -3'
Posted On 2021-07-15