Mutagenetix > Incidental Mutation

Incidental Mutation 'R4656:Tars'

352465

Institutional Source

Beutler Lab

Gene Symbol

Tars

Ensembl Gene

ENSMUSG00000022241

Gene Name

threonyl-tRNA synthetase

Synonyms

D15Wsu59e, ThrRS

MMRRC Submission

041916-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R4656 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11382301-11399665 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11394264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 96 (S96T)

Ref Sequence

ENSEMBL: ENSMUSP00000153826 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]

AlphaFold

Q9D0R2

Predicted Effect

probably benign
Transcript: ENSMUST00000022849
AA Change: S96T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: S96T

Domain	Start	End	E-Value	Type
low complexity region	21	45	N/A	INTRINSIC
Pfam:TGS	82	142	7.5e-18	PFAM
tRNA_SAD	248	297	1.91e-16	SMART
Pfam:tRNA-synt_2b	396	607	5e-38	PFAM
Pfam:HGTP_anticodon	619	710	6.5e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226597

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226904

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228207

Predicted Effect

probably damaging
Transcript: ENSMUST00000228814
AA Change: S96T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.1452

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

96% (80/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	G	A	10: 77,981,616	R59H	probably benign	Het
2310003L06Rik	G	A	5: 87,964,675		probably benign	Het
4931406B18Rik	T	A	7: 43,501,141	H69L	probably benign	Het
Ace2	T	C	X: 164,153,114	S84P	probably benign	Het
Adgb	A	C	10: 10,405,306	N656K	probably damaging	Het
Ago3	G	T	4: 126,363,752	Y495*	probably null	Het
Ahnak	G	A	19: 9,004,855	V1168M	possibly damaging	Het
Armc10	A	G	5: 21,661,550	R271G	probably benign	Het
Atp4a	T	G	7: 30,719,948		probably benign	Het
C87499	T	C	4: 88,629,965	T68A	probably benign	Het
Casp1	C	T	9: 5,304,324	P333S	probably damaging	Het
Ceacam9	C	T	7: 16,723,649	A34V	probably benign	Het
Ces1b	C	G	8: 93,057,414	E488Q	probably damaging	Het
Ces2h	A	T	8: 105,014,639	T88S	possibly damaging	Het
Col2a1	C	T	15: 97,976,176	G1375D	unknown	Het
Cyp1a1	T	C	9: 57,702,610	F436L	probably damaging	Het
Dcaf7	T	C	11: 106,053,798	V269A	probably damaging	Het
Disp2	T	C	2: 118,790,563	L592P	probably damaging	Het
Eda2r	T	A	X: 97,341,633	Q171L	probably damaging	Het
Egln2	A	G	7: 27,159,193	V408A	probably benign	Het
Gabpb2	A	G	3: 95,188,941	L325P	probably damaging	Het
Gigyf1	C	A	5: 137,525,215	Y936*	probably null	Het
Gm14149	A	T	2: 151,230,764		noncoding transcript	Het
Gnl2	C	T	4: 125,040,997	Q149*	probably null	Het
Gpr107	C	T	2: 31,214,249	T522M	probably damaging	Het
Grpr	T	A	X: 163,514,996	S351C	probably damaging	Het
Gsdma	T	C	11: 98,673,081	L287P	probably damaging	Het
Herc1	A	G	9: 66,394,711	T652A	probably damaging	Het
Ifi204	C	A	1: 173,760,361		probably benign	Het
Irx2	T	C	13: 72,631,298	S234P	probably damaging	Het
Itgal	T	A	7: 127,322,553	D808E	probably damaging	Het
Krt13	C	A	11: 100,119,363	R264L	probably damaging	Het
March1	T	A	8: 66,386,419	L38I	probably benign	Het
Megf9	T	C	4: 70,448,767	H326R	probably damaging	Het
Mif4gd	G	T	11: 115,608,337		probably benign	Het
Mroh9	A	T	1: 163,066,024	M194K	probably damaging	Het
Nhlrc3	A	G	3: 53,463,080	S22P	probably damaging	Het
Nipal2	A	T	15: 34,577,568		probably null	Het
Nr1h4	A	G	10: 89,498,253	S78P	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr390	A	T	11: 73,787,511	D191V	probably damaging	Het
Olfr607	C	T	7: 103,460,488	R235Q	probably benign	Het
Olfr908	A	T	9: 38,516,556	N175Y	probably damaging	Het
Pdzd2	A	G	15: 12,385,711	V991A	probably benign	Het
Pex1	G	A	5: 3,604,880		probably null	Het
Plch1	G	T	3: 63,704,177	A859E	probably damaging	Het
Ranbp2	A	G	10: 58,453,422	K84R	possibly damaging	Het
Rbm14	T	C	19: 4,811,435	Y25C	probably damaging	Het
Rmi2	A	G	16: 10,835,322	D78G	probably damaging	Het
Serpina3k	C	A	12: 104,345,273	T370K	probably damaging	Het
Shc2	A	T	10: 79,621,169	L538M	probably damaging	Het
Skint1	A	G	4: 112,021,477	K202R	probably damaging	Het
Slc22a29	C	A	19: 8,218,300	S125I	possibly damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Slco4c1	A	T	1: 96,841,245	D297E	probably benign	Het
Slco6d1	T	C	1: 98,423,203	F136S	probably benign	Het
Smg1	A	T	7: 118,212,951	V39E	probably benign	Het
Spns1	G	T	7: 126,374,302		probably benign	Het
Spsb1	A	G	4: 149,906,410		probably null	Het
Sspo	T	G	6: 48,454,076	I631S	possibly damaging	Het
Syne2	T	C	12: 76,031,373	L4694P	probably damaging	Het
Taf5l	T	C	8: 123,998,105	E325G	probably benign	Het
Tdrd12	T	C	7: 35,485,254	K745E	probably damaging	Het
Tenm3	A	G	8: 48,293,726	Y1015H	probably damaging	Het
Trpv3	T	A	11: 73,295,414	M677K	probably damaging	Het
Txlnb	A	T	10: 17,815,276	K191N	probably damaging	Het
Ubr1	A	G	2: 120,926,013	V711A	probably benign	Het
Uqcrb	T	C	13: 66,901,539	T41A	probably benign	Het
Usp6nl	A	G	2: 6,441,162	Y627C	probably damaging	Het
Vezf1	A	G	11: 88,074,667	D245G	probably damaging	Het
Vmn2r66	A	G	7: 85,011,996	W9R	possibly damaging	Het
Wdr17	C	T	8: 54,681,399	G349R	probably damaging	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Wrn	A	T	8: 33,335,991		probably null	Het
Zfy1	T	G	Y: 729,626	T339P	unknown	Het

Other mutations in Tars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Tars	APN	15	11388221	splice site	probably null
IGL00642:Tars	APN	15	11394372	missense	probably damaging	1.00
IGL01315:Tars	APN	15	11389734	nonsense	probably null
IGL01459:Tars	APN	15	11391854	missense	possibly damaging	0.76
IGL02141:Tars	APN	15	11391194	missense	probably damaging	0.96
IGL03292:Tars	APN	15	11384021	missense	probably benign	0.22
R0383:Tars	UTSW	15	11390325	missense	probably benign
R0517:Tars	UTSW	15	11394366	nonsense	probably null
R0685:Tars	UTSW	15	11385173	missense	probably benign
R1589:Tars	UTSW	15	11388175	missense	probably benign	0.32
R1753:Tars	UTSW	15	11394243	nonsense	probably null
R2051:Tars	UTSW	15	11393194	nonsense	probably null
R2060:Tars	UTSW	15	11394373	missense	probably benign	0.03
R2216:Tars	UTSW	15	11389708	missense	probably benign	0.00
R3610:Tars	UTSW	15	11392904	missense	probably damaging	0.99
R4844:Tars	UTSW	15	11385195	missense	possibly damaging	0.85
R4974:Tars	UTSW	15	11390391	missense	probably damaging	1.00
R5551:Tars	UTSW	15	11391982	missense	probably damaging	0.97
R5992:Tars	UTSW	15	11397196	missense	probably damaging	1.00
R6742:Tars	UTSW	15	11394341	missense	probably damaging	0.98
R6778:Tars	UTSW	15	11389699	missense	probably benign	0.06
R6850:Tars	UTSW	15	11392799	missense	probably benign
R7270:Tars	UTSW	15	11392019	missense	probably benign	0.00
R7401:Tars	UTSW	15	11392009	nonsense	probably null
R7743:Tars	UTSW	15	11399372	splice site	probably null
R8062:Tars	UTSW	15	11388314	missense	possibly damaging	0.78
R8852:Tars	UTSW	15	11393262	missense	probably benign	0.02
R8942:Tars	UTSW	15	11384097	missense	probably benign	0.27
R9205:Tars	UTSW	15	11397179	critical splice donor site	probably null
R9362:Tars	UTSW	15	11387530	missense	probably damaging	1.00
R9668:Tars	UTSW	15	11394360	nonsense	probably null
Z1088:Tars	UTSW	15	11391884	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- TGAGTCCTGACCACAAAGTTC -3'
(R):5'- CAAGGATTGCAGATTTCTTCTTCG -3'

Sequencing Primer
(F):5'- ACCACAAAGTTCCATATATAACCTTG -3'
(R):5'- GTTCTTTTACAGTTGAATCCCTGG -3'

Posted On

2015-10-08