Incidental Mutation 'R9218:Cts3'
ID 699332
Institutional Source Beutler Lab
Gene Symbol Cts3
Ensembl Gene ENSMUSG00000074870
Gene Name cathepsin 3
Synonyms 1600000I23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R9218 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 61564630-61570127 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61568769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000058359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054702] [ENSMUST00000223815] [ENSMUST00000224855] [ENSMUST00000225902]
AlphaFold Q91ZD5
Predicted Effect possibly damaging
Transcript: ENSMUST00000054702
AA Change: S18P

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058359
Gene: ENSMUSG00000074870
AA Change: S18P

DomainStartEndE-ValueType
Inhibitor_I29 29 88 2.48e-24 SMART
Pept_C1 114 331 1.33e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223815
AA Change: S18P

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224855
AA Change: S18P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000225902
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (57/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,924 T378A probably damaging Het
5430419D17Rik C T 7: 131,261,999 H1244Y unknown Het
Abcb4 A G 5: 8,927,960 M513V probably benign Het
Abhd18 T C 3: 40,916,766 probably null Het
Adamtsl4 A T 3: 95,681,094 Y561* probably null Het
Alx4 T A 2: 93,642,827 F57I possibly damaging Het
Ap3b1 A G 13: 94,448,451 probably null Het
Arsj A C 3: 126,438,465 N287H probably benign Het
Cabp4 T A 19: 4,138,694 probably null Het
Cdh6 T C 15: 13,057,470 N255S probably null Het
Ctrb1 C T 8: 111,689,508 V49M probably damaging Het
Dcst1 A T 3: 89,365,105 I17N probably benign Het
Dennd5a G A 7: 109,908,385 H823Y probably damaging Het
Dmrt2 T G 19: 25,673,702 L84R possibly damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Fsip2 C T 2: 82,992,718 P6265L probably damaging Het
Fxn T A 19: 24,262,024 K168M probably damaging Het
Hc A G 2: 35,032,191 L541P probably damaging Het
Hsd3b5 T C 3: 98,619,038 H364R probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Inf2 G A 12: 112,601,424 D163N possibly damaging Het
Iqcd C T 5: 120,600,642 P175L possibly damaging Het
Iqck C T 7: 118,941,679 A267V probably damaging Het
Kcnh1 A T 1: 192,453,630 N66I unknown Het
Kif16b T A 2: 142,699,663 E1239V possibly damaging Het
Mctp1 A G 13: 76,723,697 D362G possibly damaging Het
Muc5ac T A 7: 141,807,361 S1470T probably damaging Het
Neb A G 2: 52,293,626 probably null Het
Odc1 T A 12: 17,548,311 L151* probably null Het
Olfr1508 A T 14: 52,463,331 V226E probably damaging Het
Olfr562-ps1 T C 7: 102,782,166 I230T possibly damaging Het
Otof T A 5: 30,385,125 Q693L probably benign Het
Pitpnm2 G A 5: 124,127,281 S753F probably damaging Het
Pkd1l3 C A 8: 109,655,496 S1632* probably null Het
Pkhd1l1 A G 15: 44,520,726 T1171A possibly damaging Het
Plpp2 A G 10: 79,530,667 F104L probably damaging Het
Pmaip1 A G 18: 66,463,299 R80G probably damaging Het
Pms2 G A 5: 143,931,127 V850I probably benign Het
Psmd5 G T 2: 34,857,782 Q288K probably benign Het
Rab37 G A 11: 115,160,649 R194H probably damaging Het
Sds C T 5: 120,483,612 A273V probably damaging Het
Sema4f A G 6: 82,913,499 S776P probably benign Het
Sh3tc2 T C 18: 61,968,030 C65R probably benign Het
Siglece C T 7: 43,657,738 R275H possibly damaging Het
Slc6a12 G A 6: 121,358,664 A318T probably damaging Het
Smcr8 A T 11: 60,779,879 I618L probably benign Het
Stt3a A G 9: 36,759,260 F72L probably damaging Het
Tecpr1 T C 5: 144,217,231 K135E possibly damaging Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Tnpo2 C A 8: 85,049,980 H439N possibly damaging Het
Txlnb C T 10: 17,842,822 S467F probably damaging Het
Tyw5 G A 1: 57,396,789 P81S probably damaging Het
Uhrf1bp1 T A 17: 27,895,555 C1387S probably benign Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r220 T A 13: 23,184,439 Y29F probably benign Het
Vmn2r80 A G 10: 79,194,436 T699A possibly damaging Het
Vps9d1 G A 8: 123,250,935 T87I probably benign Het
Zcchc11 A T 4: 108,512,886 K661* probably null Het
Zfhx3 T C 8: 108,793,869 V541A probably benign Het
Zmym4 A T 4: 126,915,622 L295Q probably damaging Het
Other mutations in Cts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Cts3 APN 13 61568174 missense probably damaging 0.98
IGL02662:Cts3 APN 13 61568057 missense probably damaging 1.00
R0455:Cts3 UTSW 13 61568210 unclassified probably benign
R1673:Cts3 UTSW 13 61567554 nonsense probably null
R1793:Cts3 UTSW 13 61568153 missense probably benign 0.00
R2403:Cts3 UTSW 13 61564992 missense probably damaging 1.00
R3897:Cts3 UTSW 13 61564986 missense probably benign 0.04
R4012:Cts3 UTSW 13 61568054 critical splice donor site probably null
R4052:Cts3 UTSW 13 61568721 missense probably benign 0.27
R4669:Cts3 UTSW 13 61566823 missense probably benign 0.01
R4907:Cts3 UTSW 13 61566820 missense probably benign 0.01
R5121:Cts3 UTSW 13 61567595 missense probably benign 0.09
R5572:Cts3 UTSW 13 61564968 missense probably damaging 0.99
R5774:Cts3 UTSW 13 61568370 missense probably damaging 1.00
R5796:Cts3 UTSW 13 61568703 missense probably damaging 1.00
R5797:Cts3 UTSW 13 61568392 missense probably damaging 1.00
R6159:Cts3 UTSW 13 61566841 missense probably damaging 1.00
R6226:Cts3 UTSW 13 61568721 missense probably benign 0.27
R7346:Cts3 UTSW 13 61567620 missense probably benign 0.00
R7642:Cts3 UTSW 13 61568775 missense probably benign 0.02
R7948:Cts3 UTSW 13 61566049 missense probably benign 0.04
R8060:Cts3 UTSW 13 61566766 missense probably damaging 1.00
R9127:Cts3 UTSW 13 61567421 nonsense probably null
R9145:Cts3 UTSW 13 61564986 missense probably benign 0.04
R9707:Cts3 UTSW 13 61566835 missense possibly damaging 0.95
R9717:Cts3 UTSW 13 61564985 missense probably benign 0.00
Z1177:Cts3 UTSW 13 61568747 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTATGCTTATGTGAGTTCATG -3'
(R):5'- CCTTCATTGAGCTTTTAGTCCAAAC -3'

Sequencing Primer
(F):5'- CATGTAATTCTTCAGAAAAAGGCAG -3'
(R):5'- TTTAGCAACTTCAAAAACCTTTGG -3'
Posted On 2022-02-07