Incidental Mutation 'R0847:Gpn2'
ID77005
Institutional Source Beutler Lab
Gene Symbol Gpn2
Ensembl Gene ENSMUSG00000028848
Gene NameGPN-loop GTPase 2
SynonymsAtpbd1b
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133584362-133591735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133588595 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 199 (N199D)
Ref Sequence ENSEMBL: ENSMUSP00000101519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030661] [ENSMUST00000030662] [ENSMUST00000105899]
Predicted Effect probably benign
Transcript: ENSMUST00000030661
AA Change: N222D

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030661
Gene: ENSMUSG00000028848
AA Change: N222D

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 261 6.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030662
SMART Domains Protein: ENSMUSP00000030662
Gene: ENSMUSG00000028850

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
low complexity region 274 305 N/A INTRINSIC
G_patch 409 457 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105899
AA Change: N199D

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101519
Gene: ENSMUSG00000028848
AA Change: N199D

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 117 9.2e-42 PFAM
Pfam:ATP_bind_1 115 238 4.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148909
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Gpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01728:Gpn2 APN 4 133584502 missense possibly damaging 0.95
IGL02207:Gpn2 APN 4 133584636 missense possibly damaging 0.69
R0013:Gpn2 UTSW 4 133584792 missense probably damaging 1.00
R4233:Gpn2 UTSW 4 133584705 missense probably damaging 1.00
R4328:Gpn2 UTSW 4 133588608 missense probably benign
R5516:Gpn2 UTSW 4 133584879 intron probably null
R7641:Gpn2 UTSW 4 133588659 missense probably null 0.14
R7658:Gpn2 UTSW 4 133591376 missense probably benign 0.01
R7690:Gpn2 UTSW 4 133591382 missense probably damaging 0.99
R7747:Gpn2 UTSW 4 133586045 missense probably benign 0.02
R8137:Gpn2 UTSW 4 133588562 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGAGGACTGAACCCAGGGCTTTAC -3'
(R):5'- TGCTCATTCACACATGGGAGGAAAC -3'

Sequencing Primer
(F):5'- gtgttaggaacggaacccag -3'
(R):5'- ACTGAATGAAGTCTGCTCCTG -3'
Posted On2013-10-16