Incidental Mutation 'R0847:Pthlh'
ID77011
Institutional Source Beutler Lab
Gene Symbol Pthlh
Ensembl Gene ENSMUSG00000048776
Gene Nameparathyroid hormone-like peptide
Synonymsparathyroid hormone-like hormone, PTH-related peptide, parathyroid hormone-related peptide, parathyroid hormone-related protein, PTH-like, Pthrp
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0847 (G1)
Quality Score199
Status Not validated
Chromosome6
Chromosomal Location147252101-147264183 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 147263268 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052296] [ENSMUST00000204197]
Predicted Effect probably null
Transcript: ENSMUST00000052296
SMART Domains Protein: ENSMUSP00000051433
Gene: ENSMUSG00000048776

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204197
SMART Domains Protein: ENSMUSP00000145509
Gene: ENSMUSG00000048776

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the parathyroid family of hormones that possesses distinct paracrine and intracrine signaling roles such as regulation of circulating calcium, transplacental calcium transport, osteoclast inhibition, renal bicarbonate excretion and regulation of apoptosis. The encoded protein undergoes proteolytic processing to generate multiple active peptides with distinct signaling functions. The homozygous deletion of this gene leads to death shortly after birth with a chondrodystrophic phenotype characterized by premature chondrocyte differentiation and accelerated bone formation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dischondroplasia associated with premature maturation of chondrocytes and die postnatally from asphyxia. Mutants rescued from neonatal lethality lack mammary development and tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Pthlh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Pthlh APN 6 147252575 missense probably benign 0.15
IGL02450:Pthlh APN 6 147257168 missense possibly damaging 0.95
R2171:Pthlh UTSW 6 147257196 missense probably damaging 1.00
R2174:Pthlh UTSW 6 147257012 missense probably benign 0.00
R3123:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R3124:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R3125:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R4660:Pthlh UTSW 6 147257298 missense probably damaging 1.00
R5234:Pthlh UTSW 6 147257094 missense probably damaging 1.00
R5244:Pthlh UTSW 6 147257153 missense probably damaging 1.00
R5809:Pthlh UTSW 6 147257247 missense probably damaging 0.99
R6475:Pthlh UTSW 6 147257190 missense probably damaging 0.98
R7548:Pthlh UTSW 6 147257155 missense possibly damaging 0.56
R8144:Pthlh UTSW 6 147257165 missense probably damaging 1.00
Z1177:Pthlh UTSW 6 147263342 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCACACAGACAGTTCCTGAATCC -3'
(R):5'- GTAAAACGCCCGGTTTTCGCTC -3'

Sequencing Primer
(F):5'- GACTCCCTCTTATGGAAAGGC -3'
(R):5'- CAGTTAGAGGCGCTGATTCCTAC -3'
Posted On2013-10-16