Incidental Mutation 'R0847:Olfm2'
ID77019
Institutional Source Beutler Lab
Gene Symbol Olfm2
Ensembl Gene ENSMUSG00000032172
Gene Nameolfactomedin 2
SynonymsA030009A06Rik
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20667690-20746349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20668657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000034692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034689] [ENSMUST00000034692] [ENSMUST00000215999] [ENSMUST00000217198]
Predicted Effect probably benign
Transcript: ENSMUST00000034689
SMART Domains Protein: ENSMUSP00000034689
Gene: ENSMUSG00000032171

DomainStartEndE-ValueType
WW 6 39 3.57e-14 SMART
Pfam:Rotamase_3 45 165 1.6e-23 PFAM
Pfam:Rotamase 61 165 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034692
AA Change: V266A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034692
Gene: ENSMUSG00000032172
AA Change: V266A

DomainStartEndE-ValueType
Pfam:Noelin-1 19 118 3.8e-44 PFAM
Blast:OLF 132 177 2e-18 BLAST
OLF 190 440 4.32e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215039
Predicted Effect probably damaging
Transcript: ENSMUST00000215999
AA Change: V274A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217198
AA Change: V296A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate locomotor and anxiety-related behavioral abnormalities, altered visual evoked potential, and reduced compactness of myelin sheaths in the optic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Olfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Olfm2 APN 9 20672180 missense probably damaging 1.00
IGL03276:Olfm2 APN 9 20668787 splice site probably benign
IGL03352:Olfm2 APN 9 20668723 missense probably damaging 1.00
R0015:Olfm2 UTSW 9 20668741 missense probably damaging 1.00
R1051:Olfm2 UTSW 9 20668463 missense probably damaging 1.00
R3730:Olfm2 UTSW 9 20672767 missense probably damaging 1.00
R5366:Olfm2 UTSW 9 20668412 missense probably benign 0.04
R5665:Olfm2 UTSW 9 20668544 unclassified probably null
R5986:Olfm2 UTSW 9 20675650 missense probably damaging 1.00
R6046:Olfm2 UTSW 9 20668528 missense probably damaging 1.00
R6709:Olfm2 UTSW 9 20672713 missense probably damaging 1.00
R7020:Olfm2 UTSW 9 20668568 missense probably damaging 1.00
R7636:Olfm2 UTSW 9 20668297 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGCCCACTCTCGTCTACCATGAAG -3'
(R):5'- GCGACATGCTGATAATGGCTGACC -3'

Sequencing Primer
(F):5'- TACCATGAAGTCCATGTCCGAG -3'
(R):5'- CTGATAATGGCTGACCATGATTG -3'
Posted On2013-10-16