Incidental Mutation 'R0881:Opalin'
ID80593
Institutional Source Beutler Lab
Gene Symbol Opalin
Ensembl Gene ENSMUSG00000050121
Gene Nameoligodendrocytic myelin paranodal and inner loop protein
SynonymsTmem10, Tmp10
MMRRC Submission 039048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0881 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41062474-41077113 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 41063981 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000087176] [ENSMUST00000112200]
Predicted Effect probably benign
Transcript: ENSMUST00000051806
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087176
SMART Domains Protein: ENSMUSP00000084422
Gene: ENSMUSG00000050121

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112200
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abcc9 T A 6: 142,646,303 I732F probably damaging Het
Adam10 T C 9: 70,746,237 S248P probably damaging Het
Adam18 A T 8: 24,672,143 probably benign Het
Angel2 G A 1: 190,937,464 E114K probably damaging Het
Arhgap29 A G 3: 122,014,679 T1169A probably damaging Het
Atp13a2 T A 4: 141,003,931 M759K probably damaging Het
Atxn2l A G 7: 126,496,596 S450P probably damaging Het
B3glct T A 5: 149,739,569 V264E probably damaging Het
Bbx A G 16: 50,220,600 probably benign Het
Bmp3 A G 5: 98,872,602 N295D possibly damaging Het
C9 G A 15: 6,458,868 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cdan1 A T 2: 120,720,985 V1039E probably damaging Het
Dennd4a T C 9: 64,851,383 probably null Het
Ext1 A G 15: 53,344,483 L294P probably benign Het
Fsip2 C A 2: 82,986,273 H4117N possibly damaging Het
Itga8 C T 2: 12,262,192 probably null Het
Itln1 G T 1: 171,533,381 H48N probably benign Het
Kcna5 T A 6: 126,534,994 H57L probably benign Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Klhl25 A G 7: 75,866,279 Y6C probably damaging Het
Lars C T 18: 42,214,786 V991M probably benign Het
Med20 T C 17: 47,611,680 M1T probably null Het
Mslnl A T 17: 25,742,965 H138L possibly damaging Het
Mycbp2 T C 14: 103,220,013 I1583V probably benign Het
Nipbl A C 15: 8,307,612 V2093G probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr340 T G 2: 36,453,440 L285R probably damaging Het
Olfr557 T A 7: 102,699,084 V282D possibly damaging Het
Olfr943 A G 9: 39,184,688 K170R probably benign Het
Pgm1 A T 5: 64,093,008 T9S unknown Het
Piwil2 A C 14: 70,408,927 S387A probably benign Het
Polr1c T C 17: 46,244,613 T240A possibly damaging Het
Polr3c A G 3: 96,723,847 M118T probably damaging Het
Pth1r C T 9: 110,731,573 C42Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,791,670 M1492L probably benign Het
Rrbp1 T A 2: 143,953,253 Y1277F probably benign Het
Scgb3a2 T G 18: 43,764,484 probably benign Het
Skint1 G A 4: 112,028,857 S327N probably benign Het
Steap4 A T 5: 7,980,388 S415C probably benign Het
Tex48 A G 4: 63,611,991 probably benign Het
Tox2 T A 2: 163,321,445 S502T probably benign Het
Usp47 T A 7: 112,091,436 I762K possibly damaging Het
Vmn2r53 T C 7: 12,600,932 H267R probably benign Het
Wnt2b A G 3: 104,953,197 probably benign Het
Xirp1 T C 9: 120,018,417 N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 S550P probably benign Het
Other mutations in Opalin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Opalin APN 19 41063800 unclassified probably benign
IGL02025:Opalin APN 19 41072235 splice site probably benign
IGL02282:Opalin APN 19 41066504 missense probably benign 0.40
IGL02878:Opalin APN 19 41067669 missense probably benign 0.19
BB002:Opalin UTSW 19 41063803 makesense probably null
BB012:Opalin UTSW 19 41063803 makesense probably null
R1781:Opalin UTSW 19 41067631 splice site probably null
R4579:Opalin UTSW 19 41067757 missense probably damaging 0.98
R5455:Opalin UTSW 19 41069953 missense probably benign 0.20
R5470:Opalin UTSW 19 41066531 missense probably benign 0.34
R7161:Opalin UTSW 19 41069935 missense possibly damaging 0.50
R7925:Opalin UTSW 19 41063803 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGTACAAGCCACCAAAGTCCTCTTC -3'
(R):5'- AGACGGTCTGCCAGCAATAATTAGC -3'

Sequencing Primer
(F):5'- AAAGTCCTCTTCTCCTTTCTAGTTC -3'
(R):5'- gcctgaaaaccccttgatgac -3'
Posted On2013-11-07