Incidental Mutation 'R0881:Tox2'
ID80506
Institutional Source Beutler Lab
Gene Symbol Tox2
Ensembl Gene ENSMUSG00000074607
Gene NameTOX high mobility group box family member 2
SynonymsLOC269389, RxHMG1
MMRRC Submission 039048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0881 (G1)
Quality Score123
Status Validated
Chromosome2
Chromosomal Location163203125-163324170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163321445 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 502 (S502T)
Ref Sequence ENSEMBL: ENSMUSP00000096710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099110] [ENSMUST00000109428] [ENSMUST00000165937]
Predicted Effect probably benign
Transcript: ENSMUST00000099110
AA Change: S502T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096710
Gene: ENSMUSG00000074607
AA Change: S502T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
HMG 287 357 1.44e-18 SMART
low complexity region 424 451 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109428
AA Change: S460T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105055
Gene: ENSMUSG00000074607
AA Change: S460T

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
HMG 245 315 1.44e-18 SMART
low complexity region 382 409 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
low complexity region 457 482 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148599
AA Change: S113T
SMART Domains Protein: ENSMUSP00000118219
Gene: ENSMUSG00000074607
AA Change: S113T

DomainStartEndE-ValueType
low complexity region 36 63 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165937
AA Change: S467T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126243
Gene: ENSMUSG00000074607
AA Change: S467T

DomainStartEndE-ValueType
low complexity region 75 87 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
HMG 252 322 1.44e-18 SMART
low complexity region 389 416 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abcc9 T A 6: 142,646,303 I732F probably damaging Het
Adam10 T C 9: 70,746,237 S248P probably damaging Het
Adam18 A T 8: 24,672,143 probably benign Het
Angel2 G A 1: 190,937,464 E114K probably damaging Het
Arhgap29 A G 3: 122,014,679 T1169A probably damaging Het
Atp13a2 T A 4: 141,003,931 M759K probably damaging Het
Atxn2l A G 7: 126,496,596 S450P probably damaging Het
B3glct T A 5: 149,739,569 V264E probably damaging Het
Bbx A G 16: 50,220,600 probably benign Het
Bmp3 A G 5: 98,872,602 N295D possibly damaging Het
C9 G A 15: 6,458,868 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cdan1 A T 2: 120,720,985 V1039E probably damaging Het
Dennd4a T C 9: 64,851,383 probably null Het
Ext1 A G 15: 53,344,483 L294P probably benign Het
Fsip2 C A 2: 82,986,273 H4117N possibly damaging Het
Itga8 C T 2: 12,262,192 probably null Het
Itln1 G T 1: 171,533,381 H48N probably benign Het
Kcna5 T A 6: 126,534,994 H57L probably benign Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Klhl25 A G 7: 75,866,279 Y6C probably damaging Het
Lars C T 18: 42,214,786 V991M probably benign Het
Med20 T C 17: 47,611,680 M1T probably null Het
Mslnl A T 17: 25,742,965 H138L possibly damaging Het
Mycbp2 T C 14: 103,220,013 I1583V probably benign Het
Nipbl A C 15: 8,307,612 V2093G probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr340 T G 2: 36,453,440 L285R probably damaging Het
Olfr557 T A 7: 102,699,084 V282D possibly damaging Het
Olfr943 A G 9: 39,184,688 K170R probably benign Het
Opalin T C 19: 41,063,981 probably null Het
Pgm1 A T 5: 64,093,008 T9S unknown Het
Piwil2 A C 14: 70,408,927 S387A probably benign Het
Polr1c T C 17: 46,244,613 T240A possibly damaging Het
Polr3c A G 3: 96,723,847 M118T probably damaging Het
Pth1r C T 9: 110,731,573 C42Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,791,670 M1492L probably benign Het
Rrbp1 T A 2: 143,953,253 Y1277F probably benign Het
Scgb3a2 T G 18: 43,764,484 probably benign Het
Skint1 G A 4: 112,028,857 S327N probably benign Het
Steap4 A T 5: 7,980,388 S415C probably benign Het
Tex48 A G 4: 63,611,991 probably benign Het
Usp47 T A 7: 112,091,436 I762K possibly damaging Het
Vmn2r53 T C 7: 12,600,932 H267R probably benign Het
Wnt2b A G 3: 104,953,197 probably benign Het
Xirp1 T C 9: 120,018,417 N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 S550P probably benign Het
Other mutations in Tox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Tox2 APN 2 163225466 utr 5 prime probably benign
IGL01891:Tox2 APN 2 163322983 missense possibly damaging 0.48
IGL02190:Tox2 APN 2 163323006 missense possibly damaging 0.91
IGL02576:Tox2 APN 2 163276180 missense probably damaging 0.99
R1739:Tox2 UTSW 2 163247785 missense probably damaging 0.99
R1742:Tox2 UTSW 2 163225526 missense probably benign 0.04
R1900:Tox2 UTSW 2 163276167 missense probably damaging 1.00
R1937:Tox2 UTSW 2 163225556 missense probably benign
R2345:Tox2 UTSW 2 163319598 missense probably damaging 1.00
R2842:Tox2 UTSW 2 163204630 intron probably benign
R3753:Tox2 UTSW 2 163314323 missense probably damaging 1.00
R4614:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4615:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4616:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4618:Tox2 UTSW 2 163320647 missense probably damaging 1.00
R4625:Tox2 UTSW 2 163314416 missense possibly damaging 0.71
R5410:Tox2 UTSW 2 163320373 missense probably benign 0.04
R5493:Tox2 UTSW 2 163204729 nonsense probably null
R6731:Tox2 UTSW 2 163320377 missense probably damaging 1.00
R6965:Tox2 UTSW 2 163323010 makesense probably null
R7038:Tox2 UTSW 2 163314344 missense probably damaging 0.99
R7078:Tox2 UTSW 2 163320581 missense
R7422:Tox2 UTSW 2 163321515 missense
R7577:Tox2 UTSW 2 163315902 nonsense probably null
R7829:Tox2 UTSW 2 163320376 missense probably damaging 1.00
R8356:Tox2 UTSW 2 163204630 missense unknown
R8456:Tox2 UTSW 2 163204630 missense unknown
RF011:Tox2 UTSW 2 163225564 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTCCAAGCCTCCAGTGATAGTTCC -3'
(R):5'- GCTGACAGTGACTTCTTCACATCCC -3'

Sequencing Primer
(F):5'- ccagtaaaggaaagaacccaaag -3'
(R):5'- ACCCCAGTGTCTCCCTGTG -3'
Posted On2013-11-07