Incidental Mutation 'H8441:Slc7a1'
ID82541
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8441 (G3) of strain 599
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148334545 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 535 (V535M)
Ref Sequence ENSEMBL: ENSMUSP00000117781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257]
Predicted Effect probably benign
Transcript: ENSMUST00000048116
AA Change: V535M

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: V535M

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138257
AA Change: V535M

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313
AA Change: V535M

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A C 11: 50,784,678 D677A probably damaging Het
Dido1 G T 2: 180,689,014 Q214K probably benign Het
Gm8909 T A 17: 36,167,982 Q125L possibly damaging Het
Itgbl1 A G 14: 123,973,287 N342D probably damaging Het
Mlxipl T C 5: 135,123,961 I282T probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Phf2 C T 13: 48,804,365 A1058T possibly damaging Het
Pja2 T C 17: 64,311,197 D69G probably damaging Het
Pnmt G A 11: 98,387,687 A160T probably benign Het
Pomgnt2 T G 9: 121,982,584 Y377S probably damaging Het
Scn11a T A 9: 119,807,910 I242F probably damaging Het
Stk32b T C 5: 37,457,234 D310G probably damaging Het
Sult3a2 A T 10: 33,766,478 H276Q probably benign Het
Susd5 A T 9: 114,096,185 K379* probably null Het
Tbc1d16 C A 11: 119,149,014 E656* probably null Het
Tcp10b T C 17: 13,070,861 S234P probably damaging Het
Vmo1 A G 11: 70,513,746 F143S probably damaging Het
Zfp609 T C 9: 65,794,887 E161G possibly damaging Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
R0016:Slc7a1 UTSW 5 148334583 missense probably benign 0.04
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R3722:Slc7a1 UTSW 5 148335533 nonsense probably null
R4028:Slc7a1 UTSW 5 148345812 missense probably benign 0.01
R4114:Slc7a1 UTSW 5 148342057 missense probably damaging 1.00
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5248:Slc7a1 UTSW 5 148333988 missense possibly damaging 0.91
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6370:Slc7a1 UTSW 5 148340673 missense probably damaging 1.00
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
R7007:Slc7a1 UTSW 5 148352446
R7635:Slc7a1 UTSW 5 148352236 missense probably damaging 0.99
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Z1177:Slc7a1 UTSW 5 148352165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCTGGCCGAGCCACAA -3'
(R):5'- CCCAGCTATGACACCAGCTTTTCATT -3'

Sequencing Primer
(F):5'- GAGCCACAAAGGTTCAGCTTTC -3'
(R):5'- gtccaatgggcctctctttc -3'
Posted On2013-11-08