Incidental Mutation 'H8441:Tbc1d16'
ID82556
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene NameTBC1 domain family, member 16
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8441 (G3) of strain 599
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119143045-119228499 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 119149014 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 656 (E656*)
Ref Sequence ENSEMBL: ENSMUSP00000147182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
Predicted Effect probably null
Transcript: ENSMUST00000036113
AA Change: E657*
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: E657*

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181119
Predicted Effect probably null
Transcript: ENSMUST00000207655
AA Change: E656*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A C 11: 50,784,678 D677A probably damaging Het
Dido1 G T 2: 180,689,014 Q214K probably benign Het
Gm8909 T A 17: 36,167,982 Q125L possibly damaging Het
Itgbl1 A G 14: 123,973,287 N342D probably damaging Het
Mlxipl T C 5: 135,123,961 I282T probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pes1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 11: 3,977,636 probably benign Het
Phf2 C T 13: 48,804,365 A1058T possibly damaging Het
Pja2 T C 17: 64,311,197 D69G probably damaging Het
Pnmt G A 11: 98,387,687 A160T probably benign Het
Pomgnt2 T G 9: 121,982,584 Y377S probably damaging Het
Scn11a T A 9: 119,807,910 I242F probably damaging Het
Slc7a1 C T 5: 148,334,545 V535M probably benign Het
Stk32b T C 5: 37,457,234 D310G probably damaging Het
Sult3a2 A T 10: 33,766,478 H276Q probably benign Het
Susd5 A T 9: 114,096,185 K379* probably null Het
Tcp10b T C 17: 13,070,861 S234P probably damaging Het
Vmo1 A G 11: 70,513,746 F143S probably damaging Het
Zfp609 T C 9: 65,794,887 E161G possibly damaging Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119156075 missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119156707 missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119210546 missense probably damaging 1.00
R0118:Tbc1d16 UTSW 11 119157816 missense probably damaging 1.00
R0255:Tbc1d16 UTSW 11 119147575 missense possibly damaging 0.94
R0330:Tbc1d16 UTSW 11 119158729 critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119209038 missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119154004 missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119156101 missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119155078 splice site probably benign
R2897:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R4454:Tbc1d16 UTSW 11 119157873 missense possibly damaging 0.86
R5193:Tbc1d16 UTSW 11 119158820 missense probably benign 0.00
R5465:Tbc1d16 UTSW 11 119156059 missense probably benign
R5478:Tbc1d16 UTSW 11 119155091 missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119158730 critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6233:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6596:Tbc1d16 UTSW 11 119157775 missense probably damaging 1.00
R6932:Tbc1d16 UTSW 11 119208916 missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119155095 missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119156072 missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119148958 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTATCAGGGCTCAGTAACAGGG -3'
(R):5'- TGGTTGGGAAATGACAGGCCAC -3'

Sequencing Primer
(F):5'- GAATTCCTAGAACCCCTTGTCC -3'
(R):5'- GTCAGGATTGAAGACTTTCAGC -3'
Posted On2013-11-08