Incidental Mutation 'R0905:Ndufs2'
ID83271
Institutional Source Beutler Lab
Gene Symbol Ndufs2
Ensembl Gene ENSMUSG00000013593
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 2
Synonyms
MMRRC Submission 039063-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0905 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171234853-171251388 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 171236353 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013737] [ENSMUST00000079957] [ENSMUST00000111318] [ENSMUST00000191871] [ENSMUST00000193973] [ENSMUST00000194778]
Predicted Effect probably benign
Transcript: ENSMUST00000013737
SMART Domains Protein: ENSMUSP00000013737
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 463 1.1e-131 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079957
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111318
SMART Domains Protein: ENSMUSP00000106950
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 193 236 2e-21 PFAM
Pfam:Complex1_49kDa 232 437 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150997
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193973
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,849,934 T1539M possibly damaging Het
Birc3 A T 9: 7,851,051 *138R probably null Het
Bsn C A 9: 108,105,635 D3640Y unknown Het
Bsph1 A T 7: 13,450,914 M1L probably benign Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Cfap74 G A 4: 155,418,696 probably null Het
Crtc1 A T 8: 70,391,255 S454T probably damaging Het
Cspg5 A T 9: 110,246,526 D110V probably damaging Het
Cyp2w1 A T 5: 139,356,439 Y380F probably benign Het
Dbn1 T C 13: 55,474,227 probably benign Het
Epb41l4b T C 4: 57,103,528 K103E probably damaging Het
Eps8 C T 6: 137,514,307 V358I probably benign Het
Gm12253 G T 11: 58,440,020 probably benign Het
Hltf T A 3: 20,108,869 probably null Het
Hsd17b11 C T 5: 104,009,878 V123I probably benign Het
Il31ra T A 13: 112,531,673 E481V probably damaging Het
Impdh2 A G 9: 108,561,097 probably benign Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kndc1 A C 7: 139,923,735 K985T possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lgsn A T 1: 31,203,743 Y302F probably damaging Het
Lrp1b A G 2: 41,284,185 S1541P probably damaging Het
Mast4 A G 13: 102,770,784 M528T probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Nwd1 G A 8: 72,709,449 V1436M probably damaging Het
Phf12 C T 11: 78,009,404 R109* probably null Het
Pml A G 9: 58,249,539 probably null Het
Ppfia2 T C 10: 106,819,511 I313T probably benign Het
Prdm14 C T 1: 13,125,438 G133D probably benign Het
Pygl A G 12: 70,211,017 probably benign Het
Rassf10 C T 7: 112,955,368 T392M probably damaging Het
Rpe65 T C 3: 159,601,583 S54P possibly damaging Het
Sema5b T C 16: 35,622,631 V2A probably benign Het
Sgsm3 T C 15: 81,011,345 I699T probably damaging Het
Spn T C 7: 127,136,331 T335A probably damaging Het
Tecta T C 9: 42,338,994 D1834G probably damaging Het
Trp53bp1 C A 2: 121,204,318 probably benign Het
Ttc3 A T 16: 94,456,789 K1652* probably null Het
Zadh2 A G 18: 84,095,207 H336R probably benign Het
Other mutations in Ndufs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Ndufs2 APN 1 171237229 missense probably benign 0.45
IGL02367:Ndufs2 APN 1 171239365 nonsense probably null
R1618:Ndufs2 UTSW 1 171246121 missense probably benign 0.19
R3788:Ndufs2 UTSW 1 171235320 missense possibly damaging 0.81
R4866:Ndufs2 UTSW 1 171247049 missense probably benign 0.05
R4959:Ndufs2 UTSW 1 171238009 missense probably damaging 1.00
R5788:Ndufs2 UTSW 1 171239385 missense probably damaging 1.00
R5992:Ndufs2 UTSW 1 171236418 missense probably damaging 1.00
R6141:Ndufs2 UTSW 1 171236616 missense probably damaging 1.00
R6419:Ndufs2 UTSW 1 171241099 missense probably benign 0.12
R6480:Ndufs2 UTSW 1 171236698 missense probably damaging 1.00
R7034:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
R7036:Ndufs2 UTSW 1 171238308 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCACCAGGagttgggtgtgga -3'
(R):5'- ACTGCTCACAGAGGTGTAAAGGGAA -3'

Sequencing Primer
(F):5'- tgggagacagaggcagg -3'
(R):5'- AGCCAGACAGGGTTTGATAG -3'
Posted On2013-11-08