Incidental Mutation 'R0905:Hltf'
ID 83276
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Name helicase-like transcription factor
Synonyms Snf2l3, Smarca3, P113
MMRRC Submission 039063-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0905 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 20111975-20172654 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 20163033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
AlphaFold Q6PCN7
Predicted Effect probably null
Transcript: ENSMUST00000002502
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155635
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,854,745 (GRCm39) T1539M possibly damaging Het
Birc2 A T 9: 7,851,052 (GRCm39) *138R probably null Het
Bsn C A 9: 107,982,834 (GRCm39) D3640Y unknown Het
Bsph1 A T 7: 13,184,839 (GRCm39) M1L probably benign Het
Cdkl1 A T 12: 69,803,338 (GRCm39) Y179* probably null Het
Cfap74 G A 4: 155,503,153 (GRCm39) probably null Het
Crtc1 A T 8: 70,843,905 (GRCm39) S454T probably damaging Het
Cspg5 A T 9: 110,075,594 (GRCm39) D110V probably damaging Het
Cyp2w1 A T 5: 139,342,194 (GRCm39) Y380F probably benign Het
Dbn1 T C 13: 55,622,040 (GRCm39) probably benign Het
Epb41l4b T C 4: 57,103,528 (GRCm39) K103E probably damaging Het
Eps8 C T 6: 137,491,305 (GRCm39) V358I probably benign Het
Gm12253 G T 11: 58,330,846 (GRCm39) probably benign Het
Hsd17b11 C T 5: 104,157,744 (GRCm39) V123I probably benign Het
Il31ra T A 13: 112,668,207 (GRCm39) E481V probably damaging Het
Impdh2 A G 9: 108,438,296 (GRCm39) probably benign Het
Itih5 G A 2: 10,253,999 (GRCm39) R750Q probably benign Het
Kndc1 A C 7: 139,503,651 (GRCm39) K985T possibly damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lgsn A T 1: 31,242,824 (GRCm39) Y302F probably damaging Het
Lrp1b A G 2: 41,174,197 (GRCm39) S1541P probably damaging Het
Mast4 A G 13: 102,907,292 (GRCm39) M528T probably damaging Het
Mzf1 C A 7: 12,786,698 (GRCm39) R124L possibly damaging Het
Ndufs2 T C 1: 171,063,922 (GRCm39) probably null Het
Nwd1 G A 8: 73,436,077 (GRCm39) V1436M probably damaging Het
Phf12 C T 11: 77,900,230 (GRCm39) R109* probably null Het
Pml A G 9: 58,156,822 (GRCm39) probably null Het
Ppfia2 T C 10: 106,655,372 (GRCm39) I313T probably benign Het
Prdm14 C T 1: 13,195,662 (GRCm39) G133D probably benign Het
Ptgr3 A G 18: 84,113,332 (GRCm39) H336R probably benign Het
Pygl A G 12: 70,257,791 (GRCm39) probably benign Het
Rassf10 C T 7: 112,554,575 (GRCm39) T392M probably damaging Het
Rpe65 T C 3: 159,307,220 (GRCm39) S54P possibly damaging Het
Sema5b T C 16: 35,443,001 (GRCm39) V2A probably benign Het
Sgsm3 T C 15: 80,895,546 (GRCm39) I699T probably damaging Het
Spn T C 7: 126,735,503 (GRCm39) T335A probably damaging Het
Tecta T C 9: 42,250,290 (GRCm39) D1834G probably damaging Het
Trp53bp1 C A 2: 121,034,799 (GRCm39) probably benign Het
Ttc3 A T 16: 94,257,648 (GRCm39) K1652* probably null Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20,159,796 (GRCm39) splice site probably benign
IGL01461:Hltf APN 3 20,154,103 (GRCm39) nonsense probably null
IGL01630:Hltf APN 3 20,137,068 (GRCm39) splice site probably benign
IGL01704:Hltf APN 3 20,137,910 (GRCm39) splice site probably benign
IGL02059:Hltf APN 3 20,160,621 (GRCm39) missense probably benign
IGL02105:Hltf APN 3 20,146,921 (GRCm39) missense probably damaging 1.00
IGL02156:Hltf APN 3 20,146,971 (GRCm39) missense possibly damaging 0.61
IGL02870:Hltf APN 3 20,154,037 (GRCm39) missense probably damaging 0.98
IGL02899:Hltf APN 3 20,153,981 (GRCm39) missense probably damaging 1.00
IGL02935:Hltf APN 3 20,123,215 (GRCm39) missense probably damaging 1.00
IGL02950:Hltf APN 3 20,130,736 (GRCm39) missense probably benign 0.07
IGL03082:Hltf APN 3 20,118,723 (GRCm39) splice site probably benign
snarky UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R0068:Hltf UTSW 3 20,113,254 (GRCm39) missense probably damaging 1.00
R0787:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R0980:Hltf UTSW 3 20,145,665 (GRCm39) missense probably benign 0.00
R1741:Hltf UTSW 3 20,140,352 (GRCm39) missense probably damaging 1.00
R1748:Hltf UTSW 3 20,130,685 (GRCm39) missense probably benign 0.13
R1799:Hltf UTSW 3 20,159,855 (GRCm39) missense probably damaging 1.00
R1976:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R2171:Hltf UTSW 3 20,113,245 (GRCm39) missense probably damaging 1.00
R2395:Hltf UTSW 3 20,146,906 (GRCm39) missense probably benign 0.41
R2444:Hltf UTSW 3 20,118,071 (GRCm39) missense possibly damaging 0.66
R3789:Hltf UTSW 3 20,123,211 (GRCm39) missense probably damaging 1.00
R3943:Hltf UTSW 3 20,146,908 (GRCm39) missense probably damaging 1.00
R4719:Hltf UTSW 3 20,118,865 (GRCm39) critical splice donor site probably null
R4793:Hltf UTSW 3 20,118,114 (GRCm39) missense possibly damaging 0.79
R5296:Hltf UTSW 3 20,162,276 (GRCm39) missense probably damaging 0.99
R5449:Hltf UTSW 3 20,123,247 (GRCm39) missense possibly damaging 0.92
R5492:Hltf UTSW 3 20,152,231 (GRCm39) splice site probably null
R6012:Hltf UTSW 3 20,113,098 (GRCm39) missense probably damaging 1.00
R6157:Hltf UTSW 3 20,130,660 (GRCm39) missense probably benign 0.13
R6254:Hltf UTSW 3 20,117,993 (GRCm39) missense possibly damaging 0.85
R6553:Hltf UTSW 3 20,126,558 (GRCm39) missense probably damaging 0.96
R6616:Hltf UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R6696:Hltf UTSW 3 20,119,470 (GRCm39) splice site probably null
R6761:Hltf UTSW 3 20,137,996 (GRCm39) critical splice donor site probably null
R6781:Hltf UTSW 3 20,152,330 (GRCm39) missense probably benign 0.00
R7241:Hltf UTSW 3 20,119,556 (GRCm39) missense probably benign 0.07
R7356:Hltf UTSW 3 20,163,534 (GRCm39) missense probably damaging 1.00
R7453:Hltf UTSW 3 20,136,916 (GRCm39) missense possibly damaging 0.81
R7765:Hltf UTSW 3 20,145,647 (GRCm39) missense probably benign 0.02
R7978:Hltf UTSW 3 20,146,968 (GRCm39) missense probably damaging 1.00
R8299:Hltf UTSW 3 20,136,986 (GRCm39) missense possibly damaging 0.73
R8547:Hltf UTSW 3 20,152,291 (GRCm39) missense probably damaging 1.00
R8857:Hltf UTSW 3 20,159,825 (GRCm39) missense probably damaging 0.98
R8859:Hltf UTSW 3 20,119,566 (GRCm39) nonsense probably null
R8926:Hltf UTSW 3 20,123,323 (GRCm39) critical splice donor site probably null
R8959:Hltf UTSW 3 20,136,936 (GRCm39) missense probably damaging 1.00
R9052:Hltf UTSW 3 20,152,246 (GRCm39) missense probably damaging 1.00
R9214:Hltf UTSW 3 20,140,280 (GRCm39) missense probably benign 0.01
R9405:Hltf UTSW 3 20,137,094 (GRCm39) missense possibly damaging 0.88
R9565:Hltf UTSW 3 20,136,996 (GRCm39) critical splice donor site probably null
X0027:Hltf UTSW 3 20,121,553 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTGCATTATGTCATTATGCGAACCC -3'
(R):5'- TCTCGATAAAGCAAATGCCTACTGAGC -3'

Sequencing Primer
(F):5'- GCGAACCCTACTAAAATTAGTGAGTG -3'
(R):5'- AATGCCTACTGAGCATCTGG -3'
Posted On 2013-11-08