Incidental Mutation 'R0890:Dcxr'
ID 83479
Institutional Source Beutler Lab
Gene Symbol Dcxr
Ensembl Gene ENSMUSG00000039450
Gene Name dicarbonyl L-xylulose reductase
Synonyms 1810027P18Rik, 0610038K04Rik
MMRRC Submission 039053-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0890 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 120616225-120618107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120617297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 82 (N82I)
Ref Sequence ENSEMBL: ENSMUSP00000101754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148] [ENSMUST00000142229]
AlphaFold Q91X52
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000026144
AA Change: N82I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450
AA Change: N82I

DomainStartEndE-ValueType
Pfam:adh_short 8 195 8.9e-51 PFAM
Pfam:KR 9 175 7.1e-9 PFAM
Pfam:Epimerase 10 227 2.3e-7 PFAM
Pfam:adh_short_C2 14 242 6.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026148
SMART Domains Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:KR 9 178 8.5e-8 PFAM
Pfam:adh_short 9 195 4.6e-55 PFAM
Pfam:adh_short_C2 14 242 9.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106148
AA Change: N82I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450
AA Change: N82I

DomainStartEndE-ValueType
Pfam:adh_short 8 151 2.1e-22 PFAM
Pfam:KR 9 151 4.7e-7 PFAM
Pfam:NAD_binding_10 11 182 3.9e-9 PFAM
Pfam:adh_short_C2 14 150 2.2e-8 PFAM
Pfam:adh_short_C2 157 234 4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154479
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154565
SMART Domains Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:adh_short 1 45 6.2e-10 PFAM
Pfam:adh_short_C2 33 154 9.7e-18 PFAM
Pfam:adh_short 41 123 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,972,936 (GRCm39) S837P probably benign Het
Cdh24 A G 14: 54,870,051 (GRCm39) V240A probably benign Het
Clcn4 T C 7: 7,291,964 (GRCm39) T556A possibly damaging Het
Coa7 G A 4: 108,195,583 (GRCm39) A171T probably damaging Het
Col12a1 A T 9: 79,607,684 (GRCm39) S381R probably damaging Het
Col9a3 C T 2: 180,251,856 (GRCm39) P335L probably benign Het
Dhdh T C 7: 45,131,395 (GRCm39) D146G possibly damaging Het
Dhrs13 T A 11: 77,925,176 (GRCm39) L99Q probably null Het
Dnai1 C T 4: 41,604,253 (GRCm39) T220M possibly damaging Het
Gapvd1 T A 2: 34,602,329 (GRCm39) D606V probably damaging Het
Gcn1 T G 5: 115,717,852 (GRCm39) C246G possibly damaging Het
Gdf10 A G 14: 33,654,113 (GRCm39) K207E possibly damaging Het
Gucy2d T C 7: 98,122,472 (GRCm39) V1046A probably benign Het
Itpr3 C A 17: 27,307,985 (GRCm39) Y257* probably null Het
Kifc5b C T 17: 27,141,996 (GRCm39) T158M possibly damaging Het
Klra7 C T 6: 130,195,916 (GRCm39) D251N probably benign Het
Mesp1 T C 7: 79,442,683 (GRCm39) D198G probably benign Het
Mrgprb8 T A 7: 48,038,777 (GRCm39) C149* probably null Het
Nphp4 C A 4: 152,582,677 (GRCm39) L169I possibly damaging Het
Or1j1 T A 2: 36,702,586 (GRCm39) T173S probably benign Het
Or52p2 C A 7: 102,237,408 (GRCm39) E181* probably null Het
Or5h17 T A 16: 58,820,150 (GRCm39) I34K possibly damaging Het
Pcgf5 A T 19: 36,389,544 (GRCm39) H7L probably benign Het
Polr3b A C 10: 84,550,200 (GRCm39) K970T probably benign Het
Pomgnt1 A G 4: 116,009,382 (GRCm39) D93G probably benign Het
Rnf213 A G 11: 119,321,312 (GRCm39) K1256E possibly damaging Het
Scn9a T C 2: 66,314,079 (GRCm39) T1869A probably damaging Het
Setdb2 A G 14: 59,656,669 (GRCm39) V232A possibly damaging Het
Sh3d21 T C 4: 126,044,945 (GRCm39) E578G probably damaging Het
Tmem168 A T 6: 13,603,271 (GRCm39) S32T probably damaging Het
Vmn1r38 T G 6: 66,753,514 (GRCm39) I201L probably benign Het
Wfs1 C A 5: 37,132,888 (GRCm39) W130C probably damaging Het
Other mutations in Dcxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Dcxr APN 11 120,616,993 (GRCm39) missense possibly damaging 0.75
IGL01516:Dcxr APN 11 120,616,584 (GRCm39) splice site probably null
IGL02151:Dcxr APN 11 120,616,809 (GRCm39) missense probably benign 0.00
IGL03264:Dcxr APN 11 120,617,298 (GRCm39) missense probably damaging 1.00
R1325:Dcxr UTSW 11 120,617,381 (GRCm39) splice site probably null
R1808:Dcxr UTSW 11 120,616,438 (GRCm39) splice site probably null
R2099:Dcxr UTSW 11 120,616,403 (GRCm39) missense probably damaging 1.00
R2102:Dcxr UTSW 11 120,617,133 (GRCm39) missense probably benign 0.08
R4602:Dcxr UTSW 11 120,617,130 (GRCm39) missense possibly damaging 0.49
R4772:Dcxr UTSW 11 120,616,923 (GRCm39) missense probably benign 0.00
R5028:Dcxr UTSW 11 120,617,273 (GRCm39) missense probably damaging 0.97
R5219:Dcxr UTSW 11 120,616,314 (GRCm39) unclassified probably benign
R5336:Dcxr UTSW 11 120,618,002 (GRCm39) critical splice donor site probably null
R5518:Dcxr UTSW 11 120,617,025 (GRCm39) unclassified probably benign
R6613:Dcxr UTSW 11 120,617,832 (GRCm39) missense probably benign 0.00
R6833:Dcxr UTSW 11 120,616,917 (GRCm39) missense probably damaging 1.00
R7042:Dcxr UTSW 11 120,617,841 (GRCm39) missense possibly damaging 0.66
R7531:Dcxr UTSW 11 120,617,832 (GRCm39) missense probably benign 0.00
R7633:Dcxr UTSW 11 120,617,279 (GRCm39) missense probably benign 0.00
R7710:Dcxr UTSW 11 120,617,908 (GRCm39) missense probably benign 0.08
R9128:Dcxr UTSW 11 120,617,372 (GRCm39) missense
R9800:Dcxr UTSW 11 120,618,084 (GRCm39) unclassified probably benign
Z1176:Dcxr UTSW 11 120,618,034 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACATTCACAATGGCTCCTGGAACTC -3'
(R):5'- ACCTTAGGACACAATTGCAGGACAC -3'

Sequencing Primer
(F):5'- TCACCTGAGACACCTGGATG -3'
(R):5'- GACACAATTGAGCATAGCCTTG -3'
Posted On 2013-11-08