Incidental Mutation 'R1132:Zdhhc25'
ID94762
Institutional Source Beutler Lab
Gene Symbol Zdhhc25
Ensembl Gene ENSMUSG00000054117
Gene Namezinc finger, DHHC domain containing 25
Synonyms1700030J15Rik
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88600302-88601669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88600723 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 87 (L87P)
Ref Sequence ENSEMBL: ENSMUSP00000136289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066949]
Predicted Effect probably damaging
Transcript: ENSMUST00000066949
AA Change: L87P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136289
Gene: ENSMUSG00000054117
AA Change: L87P

DomainStartEndE-ValueType
transmembrane domain 35 55 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:zf-DHHC 105 235 2.4e-32 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Zdhhc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Zdhhc25 APN 15 88601014 missense probably damaging 0.98
IGL02448:Zdhhc25 APN 15 88600842 missense probably damaging 1.00
IGL02576:Zdhhc25 APN 15 88601269 missense probably benign 0.01
R0001:Zdhhc25 UTSW 15 88600909 missense probably benign 0.00
R0394:Zdhhc25 UTSW 15 88600920 missense probably damaging 0.96
R0622:Zdhhc25 UTSW 15 88601107 missense probably damaging 0.98
R1116:Zdhhc25 UTSW 15 88600620 missense probably benign 0.25
R1854:Zdhhc25 UTSW 15 88600486 missense probably benign
R1994:Zdhhc25 UTSW 15 88600824 missense probably benign 0.00
R2102:Zdhhc25 UTSW 15 88600759 missense probably benign 0.10
R3749:Zdhhc25 UTSW 15 88601023 missense probably benign 0.00
R5144:Zdhhc25 UTSW 15 88601056 missense probably damaging 0.98
R5220:Zdhhc25 UTSW 15 88601162 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACCAACGCTGCTGGTTCATATTG -3'
(R):5'- CATTATCGCCACCAGGAGGAGAAAG -3'

Sequencing Primer
(F):5'- TGTTCCGGGACCTGCTTATA -3'
(R):5'- GGTTGTCTTCACCAATGCAG -3'
Posted On2014-01-05