Incidental Mutation 'R1132:Dhx37'
ID94693
Institutional Source Beutler Lab
Gene Symbol Dhx37
Ensembl Gene ENSMUSG00000029480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 37
SynonymsLOC381671, LOC208144
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location125413858-125434121 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125421039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 702 (I702N)
Ref Sequence ENSEMBL: ENSMUSP00000131734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169485]
Predicted Effect probably damaging
Transcript: ENSMUST00000169485
AA Change: I702N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131734
Gene: ENSMUSG00000029480
AA Change: I702N

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
low complexity region 199 231 N/A INTRINSIC
DEXDc 246 438 3.55e-27 SMART
AAA 263 463 9.3e-3 SMART
HELICc 554 669 1.56e-14 SMART
Blast:DEXDc 678 717 1e-10 BLAST
HA2 729 852 3.32e-25 SMART
Pfam:OB_NTP_bind 886 1004 1.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196444
Predicted Effect probably benign
Transcript: ENSMUST00000198746
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Dhx37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Dhx37 APN 5 125419088 missense possibly damaging 0.84
IGL02010:Dhx37 APN 5 125418713 missense possibly damaging 0.58
IGL02412:Dhx37 APN 5 125431628 missense probably damaging 0.98
IGL02484:Dhx37 APN 5 125419337 missense possibly damaging 0.89
IGL02986:Dhx37 APN 5 125419315 missense probably damaging 1.00
FR4304:Dhx37 UTSW 5 125427530 unclassified probably benign
R0010:Dhx37 UTSW 5 125431616 missense probably benign 0.02
R0019:Dhx37 UTSW 5 125430034 missense probably benign 0.36
R0485:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R0959:Dhx37 UTSW 5 125423432 missense probably benign
R1101:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R1309:Dhx37 UTSW 5 125417438 nonsense probably null
R1777:Dhx37 UTSW 5 125429931 missense probably benign
R2001:Dhx37 UTSW 5 125427464 missense probably damaging 1.00
R2116:Dhx37 UTSW 5 125421102 missense probably damaging 0.98
R3826:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3829:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R3830:Dhx37 UTSW 5 125431613 missense probably benign 0.04
R4007:Dhx37 UTSW 5 125424931 splice site probably benign
R5058:Dhx37 UTSW 5 125422231 missense probably benign 0.00
R5158:Dhx37 UTSW 5 125415152 missense probably damaging 1.00
R5436:Dhx37 UTSW 5 125429803 missense probably benign
R5789:Dhx37 UTSW 5 125421039 missense possibly damaging 0.55
R5834:Dhx37 UTSW 5 125425730 missense probably damaging 1.00
R6066:Dhx37 UTSW 5 125424666 missense probably benign 0.18
R6490:Dhx37 UTSW 5 125419132 missense probably benign 0.00
R6967:Dhx37 UTSW 5 125422167 missense probably benign 0.07
R7101:Dhx37 UTSW 5 125424942 nonsense probably null
R8036:Dhx37 UTSW 5 125424675 missense probably benign
Z1088:Dhx37 UTSW 5 125416591 missense possibly damaging 0.72
Z1177:Dhx37 UTSW 5 125424980 missense possibly damaging 0.81
Z1177:Dhx37 UTSW 5 125425472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGTCTCCCAGAGTCCAGGAAAAC -3'
(R):5'- GCCTCTGTGCCTTCCCAGAAATTG -3'

Sequencing Primer
(F):5'- CCAGGAAAACTGTTCTCATTAGGG -3'
(R):5'- CTGACGGCTGAGAGTTAGATCC -3'
Posted On2014-01-05