Mutagenetix > Incidental Mutation

Incidental Mutation 'R1107:Apba2'

98514

Institutional Source

Beutler Lab

Gene Symbol

Apba2

Ensembl Gene

ENSMUSG00000030519

Gene Name

amyloid beta precursor protein binding family A member 2

Synonyms

X11L, Mint 2, X11-like

MMRRC Submission

039180-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R1107 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64151454-64403626 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64395467 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 636 (V636I)

Ref Sequence

ENSEMBL: ENSMUSP00000146038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]

AlphaFold

P98084

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032732
AA Change: V648I

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: V648I

Domain	Start	End	E-Value	Type
low complexity region	82	96	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
PTB	368	534	6.31e-29	SMART
PDZ	578	656	6.32e-12	SMART
PDZ	670	736	1.79e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205551

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206061

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206246
AA Change: V636I

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

unknown
Transcript: ENSMUST00000206630
AA Change: V23I

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck2	T	C	6: 39,562,719 (GRCm39)	V530A	possibly damaging	Het
Cacna1b	G	A	2: 24,587,615 (GRCm39)	A625V	probably damaging	Het
Ccdc134	C	A	15: 82,018,892 (GRCm39)	R141S	possibly damaging	Het
Ccdc134	T	A	15: 82,018,895 (GRCm39)	W142R	probably damaging	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Dlg1	A	G	16: 31,665,734 (GRCm39)	E697G	probably benign	Het
Fezf2	A	T	14: 12,342,624 (GRCm38)	C414S	probably damaging	Het
Kif26b	A	C	1: 178,745,238 (GRCm39)	N1778T	probably benign	Het
Lrp1	T	C	10: 127,393,304 (GRCm39)	Y2683C	probably damaging	Het
Mroh7	T	C	4: 106,564,791 (GRCm39)		probably null	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Pclo	T	A	5: 14,727,883 (GRCm39)		probably benign	Het
Rnf220	C	A	4: 117,142,587 (GRCm39)	G114V	probably damaging	Het
Tasor	C	T	14: 27,201,680 (GRCm39)	Q49*	probably null	Het
Zik1	G	A	7: 10,224,312 (GRCm39)	R262C	probably damaging	Het

Other mutations in Apba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Apba2	APN	7	64,386,689 (GRCm39)	missense	possibly damaging	0.79
IGL01716:Apba2	APN	7	64,395,574 (GRCm39)	splice site	probably benign
IGL02218:Apba2	APN	7	64,345,425 (GRCm39)	missense	probably benign	0.01
IGL02343:Apba2	APN	7	64,344,894 (GRCm39)	missense	probably damaging	0.96
IGL03265:Apba2	APN	7	64,345,071 (GRCm39)	missense	probably damaging	1.00
guadalupe	UTSW	7	64,399,912 (GRCm39)	missense	probably damaging	1.00
LCD18:Apba2	UTSW	7	64,271,908 (GRCm39)	intron	probably benign
R0395:Apba2	UTSW	7	64,393,156 (GRCm39)	missense	probably benign	0.00
R0554:Apba2	UTSW	7	64,395,528 (GRCm39)	missense	probably damaging	1.00
R0624:Apba2	UTSW	7	64,364,263 (GRCm39)	splice site	probably null
R0733:Apba2	UTSW	7	64,399,912 (GRCm39)	missense	probably damaging	1.00
R1464:Apba2	UTSW	7	64,345,297 (GRCm39)	missense	probably benign
R1464:Apba2	UTSW	7	64,345,297 (GRCm39)	missense	probably benign
R1486:Apba2	UTSW	7	64,386,696 (GRCm39)	missense	probably damaging	1.00
R1895:Apba2	UTSW	7	64,394,378 (GRCm39)	critical splice donor site	probably null
R1942:Apba2	UTSW	7	64,345,218 (GRCm39)	missense	possibly damaging	0.92
R1946:Apba2	UTSW	7	64,394,378 (GRCm39)	critical splice donor site	probably null
R2002:Apba2	UTSW	7	64,383,290 (GRCm39)	missense	probably damaging	0.97
R2089:Apba2	UTSW	7	64,345,341 (GRCm39)	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64,345,341 (GRCm39)	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64,345,341 (GRCm39)	missense	probably benign	0.02
R2571:Apba2	UTSW	7	64,395,498 (GRCm39)	missense	probably damaging	0.98
R3035:Apba2	UTSW	7	64,389,540 (GRCm39)	missense	probably benign	0.03
R4620:Apba2	UTSW	7	64,364,215 (GRCm39)	missense	probably damaging	1.00
R5468:Apba2	UTSW	7	64,395,510 (GRCm39)	missense	probably damaging	1.00
R5478:Apba2	UTSW	7	64,344,934 (GRCm39)	nonsense	probably null
R5644:Apba2	UTSW	7	64,365,259 (GRCm39)	missense	probably benign
R5645:Apba2	UTSW	7	64,345,554 (GRCm39)	missense	possibly damaging	0.92
R5941:Apba2	UTSW	7	64,395,464 (GRCm39)	missense	probably benign	0.03
R5969:Apba2	UTSW	7	64,394,195 (GRCm39)	nonsense	probably null
R6190:Apba2	UTSW	7	64,389,628 (GRCm39)	missense	probably damaging	0.98
R6806:Apba2	UTSW	7	64,345,207 (GRCm39)	missense	probably damaging	1.00
R7098:Apba2	UTSW	7	64,386,696 (GRCm39)	missense	probably damaging	1.00
R7143:Apba2	UTSW	7	64,394,165 (GRCm39)	missense	probably damaging	1.00
R7183:Apba2	UTSW	7	64,383,293 (GRCm39)	missense	probably benign	0.11
R7260:Apba2	UTSW	7	64,389,493 (GRCm39)	missense	probably damaging	1.00
R7479:Apba2	UTSW	7	64,389,607 (GRCm39)	missense	possibly damaging	0.63
R7677:Apba2	UTSW	7	64,344,845 (GRCm39)	missense	probably benign	0.02
R7959:Apba2	UTSW	7	64,345,571 (GRCm39)	missense	probably benign
R8325:Apba2	UTSW	7	64,345,730 (GRCm39)	missense	probably benign	0.02
R8376:Apba2	UTSW	7	64,345,341 (GRCm39)	missense	probably benign	0.02
R8411:Apba2	UTSW	7	64,386,674 (GRCm39)	missense	probably damaging	0.99
R8412:Apba2	UTSW	7	64,395,546 (GRCm39)	missense	probably damaging	1.00
R8857:Apba2	UTSW	7	64,399,939 (GRCm39)	missense	possibly damaging	0.76
R9040:Apba2	UTSW	7	64,393,072 (GRCm39)	missense	possibly damaging	0.82
R9265:Apba2	UTSW	7	64,393,020 (GRCm39)	missense	probably damaging	0.99
R9356:Apba2	UTSW	7	64,345,421 (GRCm39)	missense	probably damaging	1.00
R9569:Apba2	UTSW	7	64,393,138 (GRCm39)	missense	possibly damaging	0.64
R9667:Apba2	UTSW	7	64,345,062 (GRCm39)	missense	possibly damaging	0.67
Z1177:Apba2	UTSW	7	64,399,983 (GRCm39)	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CAGCAACTCCTCAGGTTCTCACAG -3'
(R):5'- TAGTCCCCAAGGGAAGACGCTATG -3'

Sequencing Primer
(F):5'- CTCAGGTTCTCACAGAGCAG -3'
(R):5'- TCTCCATAGGCAGAGTAGCAC -3'

Posted On

2014-01-05