Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Apba2'

559110

Institutional Source

Beutler Lab

Gene Symbol

Apba2

Ensembl Gene

ENSMUSG00000030519

Gene Name

amyloid beta (A4) precursor protein-binding, family A, member 2

Synonyms

X11L, X11-like, Mint 2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64501706-64753878 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64733545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 369 (D369N)

Ref Sequence

ENSEMBL: ENSMUSP00000032732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]

AlphaFold

P98084

Predicted Effect

probably benign
Transcript: ENSMUST00000032732
AA Change: D369N

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: D369N

Domain	Start	End	E-Value	Type
low complexity region	82	96	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
PTB	368	534	6.31e-29	SMART
PDZ	578	656	6.32e-12	SMART
PDZ	670	736	1.79e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206246
AA Change: D369N

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Pfkl	G	A	10: 78,002,082	R31*	probably null	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Apba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Apba2	APN	7	64736941	missense	possibly damaging	0.79
IGL01716:Apba2	APN	7	64745826	splice site	probably benign
IGL02218:Apba2	APN	7	64695677	missense	probably benign	0.01
IGL02343:Apba2	APN	7	64695146	missense	probably damaging	0.96
IGL03265:Apba2	APN	7	64695323	missense	probably damaging	1.00
guadalupe	UTSW	7	64750164	missense	probably damaging	1.00
LCD18:Apba2	UTSW	7	64622160	intron	probably benign
R0395:Apba2	UTSW	7	64743408	missense	probably benign	0.00
R0554:Apba2	UTSW	7	64745780	missense	probably damaging	1.00
R0624:Apba2	UTSW	7	64714515	splice site	probably null
R0733:Apba2	UTSW	7	64750164	missense	probably damaging	1.00
R1107:Apba2	UTSW	7	64745719	missense	possibly damaging	0.51
R1464:Apba2	UTSW	7	64695549	missense	probably benign
R1464:Apba2	UTSW	7	64695549	missense	probably benign
R1486:Apba2	UTSW	7	64736948	missense	probably damaging	1.00
R1895:Apba2	UTSW	7	64744630	critical splice donor site	probably null
R1942:Apba2	UTSW	7	64695470	missense	possibly damaging	0.92
R1946:Apba2	UTSW	7	64744630	critical splice donor site	probably null
R2002:Apba2	UTSW	7	64733542	missense	probably damaging	0.97
R2089:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2571:Apba2	UTSW	7	64745750	missense	probably damaging	0.98
R3035:Apba2	UTSW	7	64739792	missense	probably benign	0.03
R4620:Apba2	UTSW	7	64714467	missense	probably damaging	1.00
R5468:Apba2	UTSW	7	64745762	missense	probably damaging	1.00
R5478:Apba2	UTSW	7	64695186	nonsense	probably null
R5644:Apba2	UTSW	7	64715511	missense	probably benign
R5645:Apba2	UTSW	7	64695806	missense	possibly damaging	0.92
R5941:Apba2	UTSW	7	64745716	missense	probably benign	0.03
R5969:Apba2	UTSW	7	64744447	nonsense	probably null
R6190:Apba2	UTSW	7	64739880	missense	probably damaging	0.98
R6806:Apba2	UTSW	7	64695459	missense	probably damaging	1.00
R7098:Apba2	UTSW	7	64736948	missense	probably damaging	1.00
R7143:Apba2	UTSW	7	64744417	missense	probably damaging	1.00
R7260:Apba2	UTSW	7	64739745	missense	probably damaging	1.00
R7479:Apba2	UTSW	7	64739859	missense	possibly damaging	0.63
R7677:Apba2	UTSW	7	64695097	missense	probably benign	0.02
R7959:Apba2	UTSW	7	64695823	missense	probably benign
R8325:Apba2	UTSW	7	64695982	missense	probably benign	0.02
R8376:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R8411:Apba2	UTSW	7	64736926	missense	probably damaging	0.99
R8412:Apba2	UTSW	7	64745798	missense	probably damaging	1.00
R8857:Apba2	UTSW	7	64750191	missense	possibly damaging	0.76
R9040:Apba2	UTSW	7	64743324	missense	possibly damaging	0.82
R9265:Apba2	UTSW	7	64743272	missense	probably damaging	0.99
R9356:Apba2	UTSW	7	64695673	missense	probably damaging	1.00
R9569:Apba2	UTSW	7	64743390	missense	possibly damaging	0.64
R9667:Apba2	UTSW	7	64695314	missense	possibly damaging	0.67
Z1177:Apba2	UTSW	7	64750235	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- CCCCATTTCTGCAGAGTGATC -3'
(R):5'- ATTTCAGAGCTCCCTCCAGG -3'

Sequencing Primer
(F):5'- CTGCAGAGTGATCTAGCCATG -3'
(R):5'- CCTGCATCATTCGGATGT -3'

Posted On

2019-06-26