Incidental Mutation 'R1216:Dppa4'
ID99685
Institutional Source Beutler Lab
Gene Symbol Dppa4
Ensembl Gene ENSMUSG00000058550
Gene Namedevelopmental pluripotency associated 4
Synonyms2410091M23Rik, ECAT15-1
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48283733-48294237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48292980 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 244 (F244S)
Ref Sequence ENSEMBL: ENSMUSP00000093749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050705] [ENSMUST00000096045]
Predicted Effect probably benign
Transcript: ENSMUST00000050705
AA Change: F192S

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093748
Gene: ENSMUSG00000058550
AA Change: F192S

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 125 142 N/A INTRINSIC
Pfam:DCR 169 236 1.2e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000096045
AA Change: F244S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093749
Gene: ENSMUSG00000058550
AA Change: F244S

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Blast:SAP 81 115 3e-9 BLAST
Pfam:Dppa2_A 123 158 1.2e-3 PFAM
Pfam:Dppa2_A 173 219 1.1e-9 PFAM
Pfam:DCR 221 287 1.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231359
Meta Mutation Damage Score 0.8304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal and postnatal lethality, abnormal lung morphology, skeletal defects, and a maternal effect on female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Dppa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Dppa4 APN 16 48291083 missense possibly damaging 0.78
IGL02527:Dppa4 APN 16 48289093 missense possibly damaging 0.93
R0138:Dppa4 UTSW 16 48291062 missense probably benign 0.25
R0346:Dppa4 UTSW 16 48289324 splice site probably benign
R1453:Dppa4 UTSW 16 48291233 missense probably damaging 1.00
R1852:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
R4452:Dppa4 UTSW 16 48289336 missense probably benign 0.38
R5133:Dppa4 UTSW 16 48292971 missense probably benign 0.18
R5616:Dppa4 UTSW 16 48291030 missense probably damaging 1.00
R5665:Dppa4 UTSW 16 48291015 missense probably benign
R5947:Dppa4 UTSW 16 48291108 missense possibly damaging 0.78
R5993:Dppa4 UTSW 16 48289346 nonsense probably null
R6018:Dppa4 UTSW 16 48289127 nonsense probably null
R6701:Dppa4 UTSW 16 48291311 nonsense probably null
R6719:Dppa4 UTSW 16 48287884 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGTGTTAGAATCACTCATGCAGGC -3'
(R):5'- ATGAACCTTTCCCGCAGGCAAC -3'

Sequencing Primer
(F):5'- TCACTCATGCAGGCTAAAGG -3'
(R):5'- TATGAACACACTTGGGGCACAG -3'
Posted On2014-01-15