Phenotypic Mutation 'torticollis' (pdf version)
Mutation Type critical splice donor site (1 bp from exon)
Coordinate80,288,217 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Myo6
Gene Name myosin VI
Synonym(s) Tlc
Chromosomal Location 80,165,031-80,311,729 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001039546; MGI: 104785

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036181 ] [ENSMUSP00000075501 ] [ENSMUSP00000108891 ] [ENSMUSP00000108893 ] [ENSMUSP00000139228 ] [ENSMUSP00000139019 ]   † probably from a misspliced transcript
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577

MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577

MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577

MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577

MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577

MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577

MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Predicted Effect probably null
Meta Mutation Damage Score 0.9472 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 5890120
dsDNA induced type I IFN production - increased
hearing/vestibular/ear 5890120
impaired response to dsDNA- type I IFN production by macrophages
Candidate Explorer Status CE: not good candidate; Verification probability: 0.174; ML prob: 0.224; human score: -1.5
Single pedigree
Linkage Analysis Data
Alleles Listed at MGI

All alleles(12) : Targeted(4) Gene trapped(1) Spontaneous(6) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
truths UTSW 9 80270039 nonsense probably null
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0791:Myo6 UTSW 9 80262374 splice site probably benign
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R1978:Myo6 UTSW 9 80228925 missense probably damaging 0.99
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2092:Myo6 UTSW 9 80245682 missense probably damaging 1.00
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 splice site probably null
R2898:Myo6 UTSW 9 80269611 splice site probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5200:Myo6 UTSW 9 80276374 nonsense probably null
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R6693:Myo6 UTSW 9 80245731 missense probably damaging 1.00
R7151:Myo6 UTSW 9 80245136 missense unknown
R7399:Myo6 UTSW 9 80262291 missense unknown
R7492:Myo6 UTSW 9 80288046 nonsense probably null
R7651:Myo6 UTSW 9 80264266 critical splice donor site probably null
R7698:Myo6 UTSW 9 80217656 missense unknown
R7743:Myo6 UTSW 9 80276329 missense unknown
R7888:Myo6 UTSW 9 80296665 missense probably damaging 0.99
R8161:Myo6 UTSW 9 80217709 missense unknown
R8245:Myo6 UTSW 9 80254947 missense unknown
R8375:Myo6 UTSW 9 80254924 missense unknown
R8387:Myo6 UTSW 9 80276350 missense unknown
R8467:Myo6 UTSW 9 80228886 missense probably damaging 1.00
R8669:Myo6 UTSW 9 80266249 missense unknown
R8770:Myo6 UTSW 9 80264199 missense unknown
Z1191:Myo6 UTSW 9 80242227 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, gDNA
MMRRC Submission 038164-MU
Last Updated 2019-09-04 9:47 PM by Anne Murray
Record Created 2014-12-18 5:54 PM by Jeff SoRelle
Record Posted 2015-02-12
Phenotypic Description

Figure 1. The torticollis phenotype.

The torticollis phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1609, some of which showed increased locomotor activity, head tossing, and circling behavior (Figure 1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 47 mutations. A mutation in Myo6 was presumed to be causative because the torticollis phenotype mirrored the mayday_circler phenotype attributed to Myo6 as well as other Myo6 alleles (see MGI). The mutation in Myo6 is a G to A transition at base pair 80,288,217 (v38) on chromosome 9, or base pair 123,242 in the GenBank genomic region NC_000075 within the donor splice site of intron 26. The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 209-nucleotide exon 26 (out of 33 total exons), resulting in a frame-shift and coding of two aberrant amino acids followed by a premature stop codon after amino acid 888.


              <--exon 25      <--exon 26 intron 26-->        exon 27-->

882    ……-M--A--K--I--K-……-E--E--R--R--M                   ……-E--T--*
             correct         deleted                         aberrant
The donor splice site of intron 26, which is destroyed by the torticollis mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 
Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 2. Domain structure of myosin VI. At its N-terminus, myosin VI has an ATP- and actin-binding catalytic head with converter domain. Two inserted sequences close to the nucleotide-binding pocket and between the converter domain and canonical IQ domain serve, respectively, to slow the rate of ATP binding to the lead head in a dimer and to reverse the directionality of myosin VI movement along the actin filament relative to other myosins. Both insert-2 and the canonical IQ domain bind to calmodulin light chains. The C-terminal tail consists of a cargo-binding domain, and proximal (PT) and medial tail (MT) domains, one of which may provide a lever arm extension that accounts for the large step size of myosin VI. Alternative splicing of the tail domain results in the possible inclusion of one or two inserted sequences; the sequences may affect the function of myosin VI in endocytosis. The torticollis mutation is designated by a red asterisk. Image is interactive; click to view other myosin VI mutations.

Myo6 encodes myosin VI, a member of the unconventional myosin family that function as actin-based molecular motors for various cellular cargoes, producing mechanical force through repeated cycles of ATP hydrolysis. Like other myosins, myosin VI has at its N-terminus a catalytic head with converter domain followed by a single canonical light chain-binding domain (Figure 2) (1;2).  The myosin VI tail consists of a proximal tail domain (also called the lever arm extension, LAE), a medial tail domain (also called the single α-helix domain, SAH), and a globular cargo-binding domain. In mammalian cells, alternative splicing of the tail domain gives rise to four distinct myosin VI isoforms that may localize and function differentially in cells (3). The four isoforms contain either a large insert (21-31 amino acids) at the C-terminal end of the medial tail domain, a small insert (9 amino acids) within the cargo-binding domain, both inserts, or no insert. The torticollis mutation is predicted to result in coding of a premature stop codon within the proximal tail domain.


Please see the record mayday­_circler for information about Myo6.

Putative Mechanism

Myosin VI is involved in membrane trafficking, both exocytosis and endocytosis [reviewed in (4)].  MYO6 mutations have been linked with both dominant (OMIM #606346) (5) and recessive non-syndromic hearing loss (OMIM #607821) (6), as well as with dominant syndromic hearing loss that includes hypertrophic cardiomyopathy (7). A mutation in mouse myosin VI was implicated through positional cloning as the cause of Snell’s waltzer (sv) phenotype (8), which arose spontaneously in 1960 and is characterized by circling behavior, head tossing, deafness, and hyperactivity observable by 12 days of age (9). Although the appearance of hair cells and their stereocilia is relatively normal at birth in homozygous Myo6sv/sv mice, the stereocilia undergo progressive disorganization and a raising of the hair cell apical plasma membrane between stereocilia such that by three days of age all hair cells show fused stereocilia and by 20 days giant stereocilia are observed on top of hair cells (10). The formation of stereocilial branches is also observed at one day of age (11). By 6 weeks, there is a complete degeneration of both inner and outer hair cells within the Organ of Corti (8). The phenotype of the torticollis mice is consistent with a loss-of-function mutation in Myo6; the expression and localization of the myosin VItorticollis protein have not been examined.

Primers PCR Primer

Sequencing Primer
torticollis_seq_R: cttactcatacacacacacacac

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 203 nucleotides is amplified (chromosome 9, + strand):

1   accatgatga cgagggagca gatacagaaa gagtatgatg cacttgttaa aagctcagaa
61  gatctcctca gtgcactgca gaaaaagaaa cagcaagagg aggaggccga gaggctgagg
121 cgcatccagg aggagatgga gaaagaaagg aagaggcgtg aagaagatga ggaacgtcgg
181 cggaaggagg aagaggagag gcg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhe Chen, Doan Dao