Incidental Mutation 'R1352:Gm5422'
ID156709
Institutional Source Beutler Lab
Gene Symbol Gm5422
Ensembl Gene ENSMUSG00000039684
Gene Namepredicted pseudogene 5422
Synonyms
MMRRC Submission 039417-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R1352 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location31248140-31251045 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 31250735 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050717
SMART Domains Protein: ENSMUSP00000135967
Gene: ENSMUSG00000039684

DomainStartEndE-ValueType
low complexity region 44 61 N/A INTRINSIC
Pfam:PC_rep 438 474 6.8e-9 PFAM
Pfam:PC_rep 475 509 1.1e-8 PFAM
SCOP:d1gw5a_ 603 760 4e-4 SMART
PDB:4CR4|Z 648 901 1e-50 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216161
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.5%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,135,468 probably benign Het
Acbd3 T A 1: 180,738,530 Y263N probably damaging Het
Aldh4a1 T C 4: 139,635,519 V142A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Cass4 T C 2: 172,416,495 S138P probably damaging Het
Cbln4 T C 2: 172,037,456 K171E possibly damaging Het
Cd226 A G 18: 89,247,174 Y79C probably damaging Het
Dclre1a T C 19: 56,545,163 D333G probably damaging Het
Dst T A 1: 34,229,248 probably null Het
Eml5 A G 12: 98,831,003 probably benign Het
Evx1 T C 6: 52,317,010 S388P probably damaging Het
Gins1 T A 2: 150,930,848 L177* probably null Het
Gmppa T A 1: 75,440,534 D204E probably benign Het
Ifna7 A C 4: 88,816,660 T145P possibly damaging Het
Inhbb T C 1: 119,420,695 D131G probably benign Het
Itpr2 T C 6: 146,111,742 K2679E probably damaging Het
Kif20b C A 19: 34,924,635 H4N probably benign Het
Kng1 G T 16: 23,067,694 probably null Het
Lrrfip1 C T 1: 91,115,367 A498V probably benign Het
Myo3a T A 2: 22,323,675 probably null Het
Nkapl T C 13: 21,468,060 R128G unknown Het
Olfr1350 A T 7: 6,570,783 Y264F probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Prlr T C 15: 10,328,786 V449A probably benign Het
Rbm44 C A 1: 91,153,042 D317E probably damaging Het
Sirt5 T C 13: 43,394,807 S310P probably damaging Het
Spice1 T C 16: 44,386,822 S856P probably damaging Het
Sptan1 T A 2: 30,021,187 probably benign Het
St6gal1 A G 16: 23,321,651 K191E probably damaging Het
Stat6 A T 10: 127,650,811 Q152L probably benign Het
Stk3 T C 15: 35,008,225 D253G probably damaging Het
Tas2r139 C T 6: 42,140,940 A2V probably benign Het
Tfpi2 A G 6: 3,968,281 L15P probably damaging Het
Topbp1 T A 9: 103,347,008 C1445S probably benign Het
Trappc11 A T 8: 47,525,046 H195Q possibly damaging Het
Ttc21a A T 9: 119,954,652 E600V possibly damaging Het
Ttn T C 2: 76,846,697 probably benign Het
Vmn2r88 T C 14: 51,418,550 S740P probably damaging Het
Wrn A C 8: 33,294,916 V476G probably benign Het
Zdbf2 C A 1: 63,303,053 A197E probably damaging Het
Other mutations in Gm5422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Gm5422 APN 10 31249436 exon noncoding transcript
IGL01569:Gm5422 APN 10 31249901 exon noncoding transcript
IGL01645:Gm5422 APN 10 31250073 exon noncoding transcript
IGL02273:Gm5422 APN 10 31250007 exon noncoding transcript
IGL02603:Gm5422 APN 10 31249440 exon noncoding transcript
IGL02928:Gm5422 APN 10 31250254 exon noncoding transcript
IGL03003:Gm5422 APN 10 31250844 exon noncoding transcript
IGL03274:Gm5422 APN 10 31250352 exon noncoding transcript
IGL03297:Gm5422 APN 10 31249731 exon noncoding transcript
ANU23:Gm5422 UTSW 10 31249436 exon noncoding transcript
R0010:Gm5422 UTSW 10 31249754 exon noncoding transcript
R0506:Gm5422 UTSW 10 31250322 exon noncoding transcript
R0560:Gm5422 UTSW 10 31249244 exon noncoding transcript
R0573:Gm5422 UTSW 10 31250160 exon noncoding transcript
R0652:Gm5422 UTSW 10 31249281 exon noncoding transcript
R1210:Gm5422 UTSW 10 31250723 intron noncoding transcript
R1259:Gm5422 UTSW 10 31249115 exon noncoding transcript
R1631:Gm5422 UTSW 10 31249806 exon noncoding transcript
R1707:Gm5422 UTSW 10 31248462 exon noncoding transcript
R1893:Gm5422 UTSW 10 31249613 exon noncoding transcript
R2011:Gm5422 UTSW 10 31248768 exon noncoding transcript
R2132:Gm5422 UTSW 10 31248933 exon noncoding transcript
R3427:Gm5422 UTSW 10 31248846 exon noncoding transcript
R3772:Gm5422 UTSW 10 31248514 exon noncoding transcript
R4703:Gm5422 UTSW 10 31249612 exon noncoding transcript
R5539:Gm5422 UTSW 10 31248650 exon noncoding transcript
R5603:Gm5422 UTSW 10 31250844 exon noncoding transcript
R5660:Gm5422 UTSW 10 31250052 exon noncoding transcript
R6124:Gm5422 UTSW 10 31249400 exon noncoding transcript
R6178:Gm5422 UTSW 10 31249692 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGACACATTTAGGGAAGGGCACAC -3'
(R):5'- TCATAGCAGGCACAACAGCGTG -3'

Sequencing Primer
(F):5'- TTTAGGGAAGGGCACACTTACC -3'
(R):5'- GTGCTAAAGACAAAAAATTCCGCTG -3'
Posted On2014-02-11