Incidental Mutation 'R1337:Cdk12'
ID156911
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 039402-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1337 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 98245671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect silent
Transcript: ENSMUST00000003203
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107538
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107539
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147441
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,769,033 S37P unknown Het
Abca12 T C 1: 71,294,819 I1175V probably benign Het
Ager G T 17: 34,600,622 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Cacna1c A G 6: 118,627,455 I1278T probably damaging Het
Casp8ap2 T C 4: 32,645,721 V1598A possibly damaging Het
Ces2g A T 8: 104,963,965 Y126F possibly damaging Het
Ehbp1l1 A T 19: 5,718,230 M1015K probably benign Het
Engase A G 11: 118,482,574 T248A possibly damaging Het
Gsdma C T 11: 98,669,707 Q162* probably null Het
Hapln3 T C 7: 79,118,076 E190G probably benign Het
Hdc T C 2: 126,616,276 Q42R probably benign Het
Larp1b C T 3: 41,033,402 P20S probably damaging Het
Macf1 T G 4: 123,476,275 R1564S probably benign Het
Muc5b A G 7: 141,858,624 Y1769C unknown Het
Nup88 T A 11: 70,944,890 Q576L probably damaging Het
Olfr566 T C 7: 102,856,871 N137S probably benign Het
Olfr836 A G 9: 19,121,803 I280V probably benign Het
Prune2 C T 19: 17,119,607 S825L possibly damaging Het
Ryr3 C A 2: 112,779,963 M2301I possibly damaging Het
Sdk2 A C 11: 113,832,331 V1278G possibly damaging Het
Sertad3 T C 7: 27,476,441 L100P probably damaging Het
Slco5a1 T C 1: 12,939,142 T370A probably benign Het
Srrm1 A G 4: 135,346,733 probably null Het
Stk32a A G 18: 43,261,349 D121G probably benign Het
Ttc7 A T 17: 87,290,296 R99W probably damaging Het
Xkr9 C A 1: 13,701,124 S288Y possibly damaging Het
Zfp644 A G 5: 106,637,554 S376P probably damaging Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTCCTGCTGAACAGACAAC -3'
(R):5'- AGTCAGGTTCTCTAGGACTAGCTTGC -3'

Sequencing Primer
(F):5'- TGCTGAACAGACAACTCCTG -3'
(R):5'- ACAGGGGCTTTACTTACCAGTATC -3'
Posted On2014-02-11